Page 396 - IJB-10-5

International Journal of Bioprinting DEX-Loaded PLGA microspheres enhance cartilage regeneration

min, and centrifugation at 12,000 × g for 15 min at 4°C. The experiment are as followed: column size = 4.6 mm × 150
RNA pellet was washed twice with 1 mL of 75% ethanol mm; particle size = 5 μm; flow rate = 1.0 mL/min; column
at 4°C, centrifuged at 12,000 × g for 10 min after each temperature = 30°C; detection wavelength = 240 nm;
washing. The RNA pellet was air-dried and then dissolved mobile phase = acetonitrile-water (35:65); and injection
in 40 μL DEPC-treated water; the RNA stock solution was volume = 5 μL. The data were recorded and analyzed.
stored at −80°C until further use.
2.14. High-performance liquid chromatography
The RNA concentration and purity was assessed using In a 5 mL volumetric flask containing 3 mL of acetonitrile,
Nanodrop (Thermo, USA). Complementary DNA (cDNA) 25 mg of the sample was added. The mixture was
was synthesized using high-capacity cDNA synthesis kit ultrasonicated for 10 min, and then diluted to the mark
(Takara, Japan), and the resultant products were stored with acetonitrile and centrifuged at 10,000 rpm for 10 min.
at −20°C. One hundred microliter of the supernatant was mixed

The cDNA was reverse-transcribed using Prime Script with 900 μL of the mobile phase in an annotation tube.
RT reagent kit (Takara, Japan). Real-time RT-PCR was The mixture was vortex-shaken for 1 min, followed by
performed with Roche 480II LightCycler and SYBR Green centrifugation at 10,000 rpm for 5 min. A C18 column was
qPCR Master Mix (Takara, Japan). Primer sequences are used to hold acetonitrile-phosphate buffer (30 mM, pH 3.5,
listed in Table 1. Gapdh was used as the reference gene. acetonitrile: buffer = 30:70, v/v) as the mobile phase. The
The thermal cycling conditions for this experiment are column temperature was set to 25°C and the flow rate to
as follows: 95°C for 600 s, 30 cycles of 95°C for 10 s each, 0.8 mL/min (0–7 min), which increased to 1.6 mL/min (8–
60°C for 15 s, and 72°C for 15 s. A melting curve (65–97°C) 12 min) and then reverted back to 0.8 mL/min. Detection
was generated afterward. The relative gene expression was should be carried out at 240 nm using a UV detector. The
calculated using 2 −ΔΔCt method. supernatant (20 μL) was injected into the HPLC system
using an automatic sampler.
2.13. Molecular weight determination
At 0 and 4 weeks, degradation of PLGA MPs samples in 2.15. Statistical analysis
vitro were collected and freeze-dried. Five milligram Statistical analyses were conducted using GraphPad
of each group of samples was measured. One millilitre Prism 6.0 software. Experimental data were derived
of tetrahydrofuran (THF) was added to each vial and from a minimum of three independent experiments and
equilibrated for 24 h for complete dissolution. The solution are expressed as mean ± standard deviation. Statistical
was filtered through 0.22 μm nylon membrane to remove significance was assessed using either the Student’s t-test or
impurities. The relative molecular weight was determined one-way ANOVA. A p-value of less than 0.05 was deemed
using LC20 high-performance liquid chromatography statistically significant. It is essential that the data conform
pump (Shimadzu, Japan). The conditions for this to a normal distribution.

Table 1. Sequences of primers used in RT-PCR. 3. Results

Gene name Primer Primer sequence (5'–3') 3.1. Characterization of MPs
Forward CGACTTCAACAGTGCCACCCA Four groups of PLGA MPs containing different
Gapdh concentrations of DEX were prepared. SEM analysis
Reverse CACCCTGTTGCTGTAGCCAAA revealed that MPs across all groups exhibited a porous
Forward CCCCTCCTCAACAGTAACGAG spherical morphology, with diameters ranging between 75
Mmp-13
Reverse AGTTTGCCTGTCACCTCTAAGC and 100 μm (Figure 2A). These surfaces displayed small
Forward GAGGCACTGGCGGAAGTCAATC pores with attached filamentous DEX crystals. Notably, as
Il-6
Reverse GAAGTGATTCTCAGCAGGCAGGTC the DEX content increased during fabrication, there was a
Forward GTCAACCTCCTCTCTGCCAT corresponding rise in the attachment of filamentous DEX
Tnf-α on the surface of MPs, confirming the effective loading
Reverse ATCCCAAAGTAGACCTGCCC
Forward GAGCAGCAAGAGCCAGAAGCA of DEX into PLGA MPs. The MPs of all groups exhibited
Col2A1 circular hollow structures (Figure 2B), indicating that
Reverse GGAGCCCTCAGTGGACAGCA there were no statistically significant differences in pore
Forward CAGAACTTTGGTAGAATCCGTAA size among the groups.
Acan
Reverse CCAGAATGGGCTCCAGACAC
Forward AATCTCCTGGACCCCTTCAT To verify the drug loading status of MPs, FT-IR
Sox-9 spectroscopy was utilized for characterization. As depicted
Reverse GTCCTCTTCGCTCTCCTTCT in Figure 2F, the stretching vibration peak of C=O bonds

Volume 10 Issue 5 (2024) 388 doi: 10.36922/ijb.3396