Page 135 - AN-3-4
P. 135

Advanced Neurology                                                Drosophila Sirtuin 1 and Alzheimer’s disease



            qRT-PCR was performed using the Step One Plus system   After  secondary antibody  incubation,  the brain tissues
            (Applied Biosystems, USA). Relative quantification was   were washed 3 times in 0.1% PBST for 15 min each and
            conducted using the “Delta-Delta Ct” (ΔΔct) method,   mounted in DABCO (Sigma-Aldrich, USA), an antifade
            normalized with the endogenous gene  RP49. Data are   medium. The samples were analyzed using a fluorescence
            presented as mean ± standard error of the mean (SEM).   microscope, and a total of 20 third-instar larval brains
            Relative mRNA levels were analyzed by one-way analysis   were examined for each genotype.
            of variance (ANOVA) followed by Tukey’s test, using
            GraphPad Prism 5.0 software. Table 1 provides details of   2.11. Statistical analysis
            the primers used for qRT-PCR.                      All  data  are  presented  as  the  mean  ± SEM,  with the
                                                               number of biological replicates indicated as “n.” For all
            2.10. Immunostaining of larval brain               experiments, the significance between genotypes was
            The immunostaining of the larval brain was performed   assessed using one-way ANOVA with Tukey’s test in
            by selecting third-instar larvae of the desired genotype.   GraphPad  Prism  5.0.  Images  were  created  with  Adobe
            Larval brains were dissected in 1X PBS and then fixed   Photoshop 7.0®. Histograms were analyzed in  GraphPad
            in 4% paraformaldehyde (PFA) for 20  min at room   Prism 5.0, with significance indicated as follows: ns, non-
            temperature (RT). The dissected brain tissues were   significant; *P < 0.05, **P < 0.01, ***P < 0.0001.
            washed 3 times in 1% PBST (1X PBS, 1% Triton X-100)   3. Results
            for 15 min each and then blocked in a 4% bovine serum
            albumin solution in 1X PBS for 2  h at RT. The tissues   3.1. Overexpression of Sirt1 modulates the
            were subsequently incubated overnight at 4°C in a   AD-related pathologies in Drosophila
            blocking solution containing primary antibodies: rabbit-  AD model flies in Drosophila showed various AD-related
            anti-P-JNK  (1:100,  Cat  #V7931,  Promega),  mouse-  pathologies in flies, including rough eyes, reduced or
            anti-Drosophila  Notch intracellular domain (NICD,   loss of survival, and impaired locomotor and phototaxis
            1:100, Cat#C17.9C6, DSHB), mouse-anti-Drosophila   behaviors.  To investigate the effect of Sirt1 overexpression
                                                                       27
            Delta extracellular domain (1:50, Cat#C594.9B, DSHB),   and its genetic interaction with AD-associated genes (Aβ ,
                                                                                                            42
            and rabbit-anti  β-Amyloid (1-43) (1:50, Cat#E8C2D,   Tau, and Appl) in fruit flies, we conducted genetic crosses
            Cell Signaling Technology, USA). Following primary   between fly lines overexpressing and downregulating
            antibody incubation, brain tissues were washed 3 times in   Sirt1 with AD  model flies  in  Drosophila  and examined
            0.1% PBST for 15 min each, then blocked with blocking   any phenotypic alterations. The phenotypic changes
            solution at RT for 1 h, and subsequently incubated with   indicated possible genetic interactions between  Sirt1
            secondary antibodies: AF-488 Goat-anti-Rabbit IgG   and AD-associated genes. In the present study, we used
            (1:150, Cat# A11008, Invitrogen), AF-488 Goat-anti-  UAS-Aβ (Human),  UAS-Tau ,  and  UAS-Appl RNAi   AD
                                                                     2
                                                                                      WT
            Mouse IgG (1:150, Cat# A11001, Invitrogen), and Anti-  model flies as well as UAS-Sirt1 to overexpress and UAS-
            Mouse Cy3 IgG (1:150, Cat# C2181, Sigma) for 2 h at RT.   Sirt1 RNAi  to downregulate Sirtuin1 in Drosophila. The UAS

            Table 1. The primers used for quantitative real‑time reverse transcription‑quantitative polymerase chain reaction
            Gene                        Forward primer sequence                       Reverse primer sequence
            Sirt1                 5′ TTTGCCCGCGAGATATATCC 3′                     5′ GCCCTTGGTCTCCAGCATT 3′
            Aβ                    5′ CGAGCGATTGCTGTTGGA 3′                       5′ TCCCGACCGCTTCTGTTC 3′
              42
            Tau                   5′CAATAGCAACACCACTTCGGATAG 3′                  5′ CGTATCTGCTGTTTGGAAACTGA 3′
            Appl                  5′ CCCAGATTGCCGTTCTCTGT 3′                     5′ TGTGGGACCCGGTTGTCTTCT 3′
            Grim                  5′ TGGATGCTGGGATCTTTTGG 3′                     5′ CGCTGGCTCGAACTGTAGCT 3′
            Reaper                5′ CGGGAGTCACAGTGGAGATTC 3′                    5′ GGTCTTCGGATGACATGAAGTG 3′
            Hid                   5′ GAGTGCCCCGCAAATCTTC 3′                      5′ CCGTGCGGAAAGAACACAT 3′
            DIAP1                 5′ TTGGTTTGGCTGGGCTTATT 3′                     5′ GGCTTGGAGTGCCATCGA 3′
            JNK                   5′ ATCAGCTCCATGACCAGGTAGAC 3′                  5′ACTTGGATCACGACAGAATGTCC 3′
            Notch                 5′ CGATGCGTTGCCAAAATG 3′                       5′ CAAAGGACACTTGCACGAGATG 3′
            Delta                 5′GCTTCACGAATCCCATCCA 3′                       5′ TCGACGATCAGCGAGAAGGT 3′
            RP49                  5′ GCAAGCCCAAGGGTATCGA 3′                      5′ ACCGATGTTGGGCATCAGA 3′


            Volume 3 Issue 4 (2024)                         4                                doi: 10.36922/an.4291
   130   131   132   133   134   135   136   137   138   139   140