Page 102 - AN-4-1

Advanced Neurology TDP-43 regulates IFN1 production

2. Materials and methods for 30 min and then centrifuged for 10 min at 16,000 × g.
The supernatant, which contained the total protein
2.1. Reagents solution for each sample, was collected. The protein
Carbobenzoxy-L-leucyl-L-leucyl-L-leucinal (MG132), concentration was measured by BCA Protein Assay Kit
chloroquine (CQ), and bafilomycin A1 (A1) were obtained (Thermo Fisher Scientific, USA). Ten micrograms of total
from Sigma-Aldrich (USA). HEK-293T cells were treated proteins were loaded and resolved on 10% SDS-PAGE gel,
with MG132 (10 µM), CQ (100 µM), or A1 (100 µM) for and subsequently transferred to polyvinylidene fluoride
16 h, followed by collection 24 h post-transfection. membranes. The membranes were blocked with 5% fat-
free milk, following established protocols. Accordingly,
15
2.2. Plasmid construction each transferred membrane was probed with a primary
Plasmids were generated as described in previous antibody overnight at 4°C. The following antibodies
protocols. 15,24 Human TDP43 was tagged with a 3x were used for immunoblot analysis: rabbit anti-TBK1,
FLAG tag at its N-terminus, and a Myc tag was fused to rabbit anti-p-TBK1 s172 , rabbit anti-IRF3, and rabbit anti-
the C-terminus using the pcDNA3 vector. Sequencing p-IRF3 s386 (1:1000 dilution; Abcam, UK), rabbit anti-
was performed to confirm the open reading frame of IRF7 (1:1000 dilution; Cell Signaling Technology, USA),
all plasmids before use. IRF3 and IRF7 plasmids, each rabbit anti-p62 (1:2000 dilution; Proteintech, USA), rabbit
harboring a FLAG tag, were obtained from GenScript anti-TDP43 (1:1000 dilution, Proteintech, USA,), and
(NJ, USA). mouse anti-GAPDH (1:5000 dilution, Proteintech, USA).

2.3. Cell culture and transfection The primary antibody solutions were removed on
the following day, and the membranes were washed.
HEK-293T cells were purchased from ATCC, USA Secondary antibody was then applied to each membrane.
and maintained in Dulbecco’s Modified Eagle Medium Chemiluminescent detection was performed using ECL
(DMEM) at 37°C in a CO incubator. The culture medium reagents (Cat. No. AR1196; Boster Biological Technology,
2
contained 10% fetal bovine serum and antibiotics USA), and imaged with a Tanon 5200 imaging system
(ampicillin and streptomycin). Plasmid transfections were (Tianneng Technology Co. Ltd, China). Band intensities
performed using Lipofectamine-2000 (Thermo Fisher were measured by Image J software (NIH, USA).
Scientific, USA) when the cells reached 70% confluency in
10-cm dishes. Cells were collected for RNA extraction 24 h 2.6. RNA extraction and quantitative polymerase
post-transfection and for immunoblot analysis 48 h post- chain reaction (qPCR)
transfection.
Myc-TBK1 and FLAG-TDP43 were co-transfected into
For dose-dependent experiments, HEK-293T cells were HEK-293T cells. Twenty-four hours post transfection,
divided into five groups. The control group was transfected cells were collected for total RNA extraction using
with 2 µg of TDP43 plasmid alone. TBK1 and TDP43 Trizol reagent (Thermo Fisher Scientific, USA). Reverse
plasmids were co-transfected in the remaining four groups transcription was performed using the ProtoScript First
(TBK1: 2 µg; TDP43: 0, 0.2, 0.5, and 1.5 µg). Cells were Strand cDNA Synthesis Kit (New England Biolabs, USA).
collected for immunoblot analysis 48 h post-transfection. One microgram of RNA was used for each reaction. SYBR
Green was used for qPCR analysis, which was conducted
2.4. CRISPR-Cas9-mediated knockout (KO) cells
on an Applied Biosystems Real-Time PCR Instrument
TDP43 KO HEK-293T cells were generated by CRISPR- (Thermo Fisher Scientific, USA). The mRNA levels of the
Cas9 technology (Addgene, USA). The Cas9 vector was targets were normalized based on GAPDH expression. The
modified to include a guide RNA targeting the TDP43 following primers (5’ – 3’; forward and reverse, respectively)
gene. Twenty-four hours post-transfection, 500 cells were used: IFN-β (GACTTACAGGTTACCTCCGAAA,
were counted and cultured in 10-cm dishes for 1 week. and CATATGCAGTACATTAGCCAT); IFN-α
Single clones (48 in total) were expanded and screened (TGACAGAGAAGAAATACAGCC, and ATTGTTT
by immunoblotting with a TDP43 antibody, followed by TCATGTTGGACCAG); IL6 (TGTGCAGATG
further confirmation through DNA Sanger sequencing. AGTACAAAAGTCCT, and ATGTCCTGCAGC
CACTGGTTC); IL8 (GCCAACACAGAAATTAT
2.5. SDS-PAGE electrophoresis TGTAAAGC, and CTGGCATCTTCACTGATTCT
The harvested cells for immunoblot analysis were lysed TG); ISG54 (CTTCCCAGTCTATCATCAACCTT,
in a protein extraction buffer on ice (1% Triton X-100). and CCGTCGCTTCTAGCTATGTATCT); ISG56 (T
The buffer contained 50 mM Tris-HCl (pH 7.4), 1 mM CATCAGGTCAAGGATAGTC, and CCACACTGTA
EDTA, and 150 mM NaCl. The lysates were incubated TTTGGTGTCTAGG); IRF3 (GTGCATCCTGCCGT

Volume 4 Issue 1 (2025) 96 doi: 10.36922/an.6272