Page 103 - AN-4-1

Advanced Neurology TDP-43 regulates IFN1 production

AGGCCGTGCTT, and ACCTGTGCCGTGGCCCGTG negatively regulates TBK1-mediated induction of IFN1
AGAA); and IRF7 (ACACCTGACCGCCACCTAACTG and related cytokines.
CC, and CGAGTTATCCCGCAGCATCA CGA).
3.2. TDP43 down-regulates TBK1-induced IRF7
2.7. Dual-luciferase reporter assay expression
The assay was performed according to the protocol from A number of studies have reported that TBK1 regulates IFN1
the company, using Dual-Luciferase Reporter Assay signaling through the phosphorylation of IRF3 and IRF7

System (Promega, USA). In HEK-293T cells, IFN-β and induces the autophagic degradation of endogenous
9
co-transfected with TBK1 and TDP43. IFN-β was tagged TDP43. In this study, the impact of TDP43 on TBK1-
with Firefly luciferase, and Renilla luciferase was used for mediated IFN1 production was investigated. HEK-293T
TK reporter, both luciferase reporters were purchased cells were transfected with TBK1 and TDP43 plasmids. The
from Addgene, USA. Twenty-four hours post-transfection, protein expressions of phosphorylated TBK1 (p-TBK1),
the luciferase activity of IFN-β was detected using the TBK1 (Myc), p-IRF3, IRF3, and IRF7 were assessed
Promega GloMax Plate Reader (Promega, USA). through immunoblot analysis (Figure 2A, Figure S1). The

TM
Finally, Firefly luciferase activity was normalized based on results revealed reduced expression of phosphorylated
Renilla luciferase activity. TBK1, IRF3, and total IRF7 in the co-transfection group
of TBK1 with TDP43 compared to the TBK1-only
2.8. Statistical analysis transfection group (Figure 2B). These findings indicate
Quantification of histological samples was performed that TDP43 may compromise TBK1 stability, leading to
independently by two blinded experimenters. Statistical reduced levels of p-IRF3 and IRF7. To further explore the
analyses were conducted with GraphPad Prism (San effect of TDP43 on TBK1 expression, TBK1 and varying
Diego, California, USA). Student’s t-test was used to amounts of TDP43 were co-transfected into HEK-293T
evaluate comparisons between two groups. One-way cells. As depicted in Figure 2C and Figure S2, the levels of
ANOVA was applied for multi-group comparisons. TBK1 and IRF7 exhibited a correlation with the changes
Results with P < 0.05 were considered statistically in TDP43 expression. Moreover, increasing amounts of
significant. The data are presented in bar graphs as the TDP43 resulted in progressively decreased expression of
mean ± standard deviation. p-TBK1 and p-IRF3. These findings implicate that TDP43
plays a crucial role in the stability of the TBK1 protein in
3. Results cells and may promote TBK1 degradation.
3.1. TDP43 negatively regulates TBK1-mediated 3.3. Overexpression of IRF7 mitigates the inhibitory
IFN1 production effect of TDP43 on TBK1-mediated IFN1 production
Activated TBK1 phosphorylates IRF3, promoting the To investigate whether overexpression of IRF3 or IRF7
induction of IFN1. In our study, it was observed that TBK1 can alleviate the inhibitory effect of TDP43 on IFN1
overexpression did not affect the IRF3 mRNA level in HEK- production, quantitative PCR analysis was performed. The
293T cells, but it resulted in elevated IFN1 and associated results revealed that the mRNA levels of IL6, IL8, IFNA,
pro-inflammatory cytokines induction (Figure 1A). IFNB, ISG54, and ISG56 were significantly increased in the
Subsequently, the impact of TDP43 co-expression on both IRF7-transfected group. However, the mRNA expression
IFN1 and cytokines in TBK1 expressed HEK-293T cells of IFNA, IFNB, IL6, and IL8 was not affected by IRF3
was investigated. The mRNA levels of IRF3, IRF7, IFN1, overexpression. In HEK-293T cells, only ISG54 and ISG56
and cytokines were also examined. TDP43 co-expression mRNA levels were increased in the IRF3-transfected group.
did not cause any change in IRF3 mRNA levels These findings indicate that enhanced overexpression of
(Figure 1A). However, quantitative PCR analysis revealed IRF7 alleviates the inhibition of TBK1-mediated IFN1 and
a significant decrease in the mRNA levels of IRF7, IFNB, related cytokine production caused by TDP43 (Figure 3A).
ISG54, and ISG56 on co-expression of TDP43. In addition, Immunoblot analysis demonstrated that overexpression
the mRNA levels of IFNA, IL6, and IL8 showed a slight IRF3 or IRF7 had no effect on the expression levels of
decrease (Figure 1A). Furthermore, a luciferase reporter p-TBK1 and TBK1 proteins (Figure 3B). Furthermore,
assay was conducted to evaluate IFN-β expression. The the dual-luciferase reporter assay confirmed a progressive
results confirmed that IFN-β production was decreased by increase in luciferase activity with increasing amounts of
TDP43 overexpression, and the inhibitory effect was more IRF7 (Figure 3C, Figure S3). These findings suggest that
pronounced with increasing levels of TDP43 expression IRF7 overexpression plays a key role in mitigating TDP43-
(Figure 1B). These findings implicate that TDP43 mediated inhibition of TBK1-induced IFN1 signaling.

Volume 4 Issue 1 (2025) 97 doi: 10.36922/an.6272