Page 260 - EJMO-9-3

Eurasian Journal of
Medicine and Oncology Metastasis gene expression in colorectal cancer

epigenetic alterations, and dynamic interactions within following the manufacturer’s protocol, using 2 μg of
the tumor microenvironment. Understanding these total RNA. The reaction mixture was processed in a PCR
mechanisms is essential for developing effective diagnostic, thermocycler (Applied Biosystems, US) with the following
prognostic, and therapeutic strategies. Ongoing research steps: denaturation at 65°C for 5 min, gDNA elimination
into the molecular and cellular mechanisms underlying at 37°C for 5 min, followed by cDNA synthesis at 37°C for
CRC will continue to inform the development of targeted 15 min, 50°C for 5 min, and 98°C for 5 min, then held at
interventions, aiming to improve both survival and quality 4°C. The resulting cDNA was diluted to 0.5 μg/μL to be
of life for those affected by this formidable disease. used as a template for subsequent RT-qPCR analysis.
2. Materials and methods PCR samples were prepared using the SensiFAST SYBR
Green No-ROX kit (Bioline, UK) and analyszed on an
2.1. Respondents Analytic Jena qTower instrument. Relative quantification
This descriptive clinical study used 41 patients as of PCR products was performed using the 2 -ΔΔCT method.
respondents during the period 2021–2022 at Dr. Sardjito Primers from Integrated DNA Technologies through
General Hospital, Yogyakarta. This study obtained ethical Genetika Science Indonesia, Singapore, were used as follows:
approval through the Institutional Review Board (IRB), TNF-α, forward 5'- CCTGCCCCAATCCCTTTATT -3'
Faculty of Medicine, Universitas Gadjah Mada, Indonesia and reverse 5'- CCCTAAGCCCCCAATTCTCT -3'; SNAI1,
(ethics number: KE/FK/0938/EC/2021). The respondents forward 5'- ACTGCAACAAGGAATACCTCAG -3' and
consisted of 20 CRC patients without metastasis and 21 reverse 5'- GCACTGGTACTTCTTGACATCTG -3'; ZEB1,
CRC patients with liver metastasis. Then, each group was forward 5'- AGCAGTGAAAGAGAAGGGAATGC -3'
also compared with adjacent normal tissue. The study’s and reverse 5'- GGTCCTCTTCAGGTGCCTCAG -3';
inclusion criteria encompassed patients diagnosed with Slug, forward 5'- ATCTGCGGCAAGGCGTTTTCCA -3'
cancer, whether metastatic or non-metastatic, who had and reverse 5'- GAGCCCTCAGATTTGACCTGTC -3';
completed the diagnostic phase, had been declared as Twist, forward 5'- GCAGGACGTGTCCAGCTC -3' and
surgery candidates, and possessed comprehensive medical reverse 5'- CTGGCTCTTCCTCGCTGTT -3'; MTA3,
records. Patients with incomplete data, lung metastasis, forward 5'- TATCAGGGGAAAGTGCAGTGTTG -3' and
reverse 5'- AACAGCATTTCTGGAATGTCTGC -3'; and
or refused to participate in the study were excluded from
the study. Confirmation and classification of samples were GAPDH, forward 5'- TGCACCACCAACTGCTTAGC -3'
based on histopathology data and computed tomography and reverse 5'- GGCATGGACTGTGGTCATGA -3'. The
scans assessed by medical personnel at the hospital. Basic mRNA expression levels of target genes were normalized
patient information was extracted from the patient’s to GAPDH expression.
medical records. Primary tumor samples were stored in 2.3. Statistical analysis
the Biobank of the Faculty of Medicine, Public Health
and Nursing, Universitas Gadjah Mada, and sent to the Data distribution was evaluated using the Kolmogorov-
Molecular Biology Laboratory, Universitas Negeri Malang, Smirnov normality test. Demographic features were
for further analysis. analyzed using ANOVA test. Comparisons between
groups were conducted using the independent samples
2.2. Marker expression analysis t-test. Associations among variables such as body mass
index (BMI), carcinoembryonic antigen (CEA), alanine
The mRNA expression levels of SNAI1, ZEB1, Slug, Twist, aminotransferase (ALT), and aspartate aminotransferase
MTA3, and TNF-α were measured by reverse transcription (AST) were assessed using Pearson correlation and
quantitative polymerase chain reaction (RT-qPCR). Total univariate linear regression analysis, while the staging
RNA was extracted from fresh frozen tissue samples parameters (T, N, and M) were analyzed using ordinal
(100 mg) using the TRISURE™/Qiazol Total RNA Isolation regression. A significance level of 5% was applied, and data
Kit (Bio line, UK) and stored at −80°C for subsequent are presented as mean ± standard error of the mean.
analysis. RNA purity was evaluated by determining
the A260/280 ratio (acceptable range: 1.8–2.0) using a 3. Results
Nanodrop spectrophotometer, and residual genomic DNA The interplay among SNAI1, ZEB1, Slug, Twist, MTA3,
(gDNA) was removed by treatment with RNAse-free and TNF-α in colon cancer involves a complex regulatory
DNase enzyme (Invitrogen, US).
network driving EMT, metastasis, and therapeutic
Complementary DNA (cDNA) synthesis was resistance. The results of this study provide compelling
performed using the High-Capacity ReverTra Ace qPCR evidence for the intricate molecular interplay underlying
®
RT Master Mix with gDNA Remover (Toyobo, Japan) EMT and metastatic progression in colon cancer. The

Volume 9 Issue 3 (2025) 252 doi: 10.36922/EJMO025210202