Page 555 - IJB-10-5

International Journal of Bioprinting 3D bioprinting of collagen hydrogels

and incubated at 37 °C with 5% CO . Cell adhesion was of differentiation-related genes in HFF-1 cells. The 2 −ΔΔCT
2
observed on days 1, 4, and 7. At each time point, CML- method, normalized to the housekeeping gene (β-actin)
scaffold-containing cells were fixed sequentially in 4% expression levels, was employed to determine the relative
paraformaldehyde for 10 mins, permeabilized with 0.1% expression levels of target genes. The primer sequences for
triton X-100 for 5 mins, and then blocked with a 1% myofibroblast genes are provided in Table 1.
bovine serum albumin (BSA) solution for 30 mins at
room temperature. Subsequently, the actin cytoskeleton 2.7. In situ extrusion with a 3D bioprinter of
was stained in the dark using phalloidin-tetramethyl CML-scaffold for full-thickness skin regeneration
rhodamine isothiocyanate (Solarbio, China) for 60 mins at 2.7.1. Animal model construction
room temperature. Nuclei were stained by incubating with Sprague-Dawley (SD) rats were selected for full-thickness
Hoechst 33258 (Solarbio, China) for 20 mins at 37 °C in the skin regeneration due to their larger size, which facilitates
dark. Subsequently, a laser confocal microscope (FV3000; more extensive surgical procedures and handling of larger
Olympus, Japan) was used to capture the fluorescence images. wound areas, allowing for a more accurate assessment of
2.6.6. Cell migration wound healing and biomaterial interactions. Their size also
The capacity of the CML-scaffold to enhance cell migration enhances the evaluation of printability and performance of
was evaluated by quantifying changes in the scratched cell multi-layer printed scaffolds, enabling better visualization
area over time. HFF-1 cells at a density of 1 × 10 cells/ and effectiveness in wound repair. Additionally, the use of
5
mL were cultured in 6-well plates with 2 mL of medium. SD rats is well-established in similar studies, providing a
After 24 hrs of incubation in a CO incubator (37 °C, 5% reliable foundation for comparison and validation of the
2
CO ), a blank area was artificially created at the bottom findings. This approach has offered valuable insights into
2
of the well plate using a white tip. Following a 24-hour both the wound-healing process and the performance of
incubation with the CML-scaffold, the migration of cells the biomaterials.
in the well plates was observed using inverted fluorescence Sixty male SD rats, weighing between 150 and 200
microscopy (IX53; Olympus, Japan) and quantitatively g, were sourced from the Lanzhou Veterinary Research
analyzed using ImageJ software. Institute (China). They were fed a standard laboratory
diet. All surgical procedures were performed following the
2.6.7. Cell differentiation guidelines approved by the Ethics Committee of the College
HFF-1 cells, at a density of 1 × 10 cells/mL, were cultured in of Chemistry and Chemical Engineering at Lanzhou
5
6-well plates containing 2 mL of medium. Following 24 hrs University (No. G09, 20220711). Prior to the modeling
of incubation in a CO incubator (37 °C, 5% CO ), the CML- procedure, rats underwent anesthesia via intraperitoneal
2
2
scaffold was placed in 6-well plates with adherent HFF-1 injection of 10% sodium pentobarbital (0.3 mL/100 g).
cells for seven days. Subsequently, cell differentiation was Subsequently, the rats’ dorsal fur was shaved, and the area
assessed by extracting total RNA using an RNA isolation was cleaned with 0.9% NaCl solution before being sterilized
kit (AG21101; Accurate Biology, China). RNA samples’ with iodophor. A circular region with a 1.0 cm diameter
concentration and purity were initially determined with was delineated on the back. Using surgical scissors, the
a spectrophotometer (Implant, Germany). Subsequently, upper skin tissue was entirely excised to create a circular
cDNA was synthesized using the PrimeScript RT reagent full-thickness skin defect wound, reaching deep into the
Kit with gDNA Eraser (Takara, Japan) and analyzed with fascia. Hemostasis procedures were then carried out.
TB Green Premix Ex Taq II (Takara, Japan). Reverse-
Transcription Quantitative Polymerase Chain Reaction 2.7.2. In situ 3D printing of CML-scaffold
(RT-qPCR) experiments were conducted using a qPCR The rats were randomly divided into the control and CML-
system (Mx 3005P; Agilent, USA) to assess the expression scaffold groups. The wounds in the control group were left

Table 1. Primer sequence of myofibroblast genes for quantitative reverse transcription polymerase chain reaction (RT-qPCR).
Gene Sequence
Forward (5ʹ–3ʹ) Reverse (5ʹ–3ʹ)
α-SMA CTGCTGAGCGTGAGATTGTC CTCAAGGGAGGATGAGGATG
Vimentin GGCTCGTCACCTTCGTGAAT GAGAAATCCTGCTCTCCTCGC
Col-I TTCACCTACAGCACGCTTGT TTGGGATGGAGGGAGTTTAC
Col-III GGTCACTTTCACTGGTTGACGA TTGAATATCAAACACGCAAGGC

Volume 10 Issue 5 (2024) 547 doi: 10.36922/ijb.4069