Page 371 - IJB-10-6

International Journal of Bioprinting 3D-printed NAFLD model

2.7. CDFDA staining of glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
Bile canaliculi formation was evaluated via the use of via the 2 −ΔΔCt method.
5(6)-carboxy-2’,7’-dichlorofluorescein diacetate. The
27
CDFDA stock solution was diluted with PBS to create a 2.10. Induction of NAFLD
5 μM working solution for staining. The samples were To induce NAFLD, we used a commonly employed
washed with PBS before being exposed to the CDFDA induction method and fatty acid ratios, creating a
working solution at 37°C for 20–30 min. Subsequently, 10 lipid culture medium composed of a base medium
μg/mL DAPI was added, and the samples were incubated supplemented with 5.5 mM glucose and a mixture of free
27,31
for 10 min. After the staining solution was removed, the fatty acids (FFAs) at 300, 600, or 900 μM. The FFAs used
in our model were a combination of palmitic acid and oleic
samples were washed with another round of PBS. Finally, acid at a 1:2 ratio. The FFA stock solution was prepared
the samples were analyzed via the CQ1 system to visualize by dissolving palmitic acid (1 M) and oleic acid (2 M) in
CDF accumulation (green) and capture images.
DMSO. This stock solution was then diluted in a culture
2.8. Immunofluorescence analysis medium supplemented with 1% BSA and incubated at
Following a similar protocol, liver tissue samples 37°C for 2 h. The lipogenic medium was introduced on day
30
were fixed with 50% FAA fixative for 60 min and then 4 to the 3D-printed liver model to induce NAFLD through
permeabilized with 0.2% Triton X-100 in PBS for 15 simple incubation. In this work, both 3D and 2D NAFLD
min. Subsequently, the samples were blocked with 2% models were developed via the experimental methods
BSA in PBS for 60 min, followed by overnight incubation described above.
with primary antibodies (albumin and CYP3A4) at 4°C. 2.11. Lipid droplet staining and quantification
The cells were then incubated with the corresponding Nile red was used to detect intracellular lipid accumulation.
secondary antibodies Alexa Fluor 488 or 594 at room The samples were fixed with FAA for 2 h at room
temperature for 40 min, and the nuclei were stained with temperature and then washed three times with PBS. The
DAPI (10 μg/mL) at room temperature for 20 min. Each samples were subsequently incubated in PBS containing
step was followed by three washes with PBS. Finally, the 2 μM Nile red and 10 μg/mL DAPI in the dark for 2 h,
samples were imaged via the CQ1 system. followed by three washes with PBS. Next, images were
taken via microscopy, with a focus on the middle section
2.9. Hepatic gene expression analysis
Quantitative reverse transcription polymerase chain of the sample. Lipid droplets were quantified by calculating
the fluorescence intensity of Nile red normalized to the cell
reaction (qRT-PCR) was conducted to compare gene area (images were processed with ImageJ). The results for
expression levels among the experimental groups. Total the control group were normalized, and those for the other
RNA was extracted from the experimental groups via experimental groups were expressed as relative multiples.
a Tissue/Cell RNA Rapid Extraction Kit according to
the manufacturer’s instructions. The RNA quantity and 2.12. Drug treatments
purity were assessed via a microvolume spectrometer (LB Both preventive and reversible effects of drugs on NAFLD
915; Colibri, Germany). Complementary DNA (cDNA) were assessed using elafibranor (ELA), a peroxisome
was synthesized via a commercial cDNA synthesis kit. proliferator-activated receptor α/δ agonist known for
qRT‒PCR was performed to compare gene expression its ability to improve lipid metabolism and reduce
levels using SYBR Green on a LightCycler 96 system inflammation. The concentrations tested (10 and 30 μM)
32
(Roche Life Science, Switzerland). The primers used were were selected based on prior NAFLD-related literature.
27
previously described, and their sequences are listed in To evaluate the preventive effects, lipogenic medium
19
Table 1. Gene expression levels were normalized to those (containing 5.5 mM glucose and 900 μM FFAs) with or

Table 1. List of Primers for qRT-PCR.
Sequence
Gene
Forward Reverse
ALB AGCATGGGCAGTAGCTCGCCT AGGTCCGCCCTGTCATCAGCA
CYP3A4 CAGGAGGAAATTGATGCAGTTTT GTCAAGATACTCCATCTGTAGCACAGT
CYP1A2 GCCTTCATCCTGGAGACCTT AGCGTTGTGTCCCTTGTTG
β-actin GAGCTGCGTGTGGCTCCC CCAGAGGCGTACAGGGATAGCA

Volume 10 Issue 6 (2024) 363 doi: 10.36922/ijb.4312