Page 42 - IJB-8-2

3D-Printed β-TCP scaffolds promote Osteogenic Differentiation of BMSCs in an m6A-Dependent Manner
Table 1. Sequences of primers used in this study
Primer Forward primer (5’ to 3’) Reverse primer (5’ to 3’)
GAPDH GGCAAGTTCAACGGCACAGT GCCAGTAGACTCCACGACAT
METTL3 CAATGTGCAGCCCAACTGGATT CACCATCTGGATACCTGTGCTT
WTAP CTCGCCTCGTCTCTTCTGG TGTTTCACTCAGTCGGACCTTT
ALKBH5 GGCTGCATCGTATCTCACGTA AGCAGCATACCCACTGAGCAC
RUNX2 TCTTCCCAAAGCCAGAGCG TGCCATTCGAGGTGGTCG
OPN GAGGAGAAGGCGCATTACAG AAACGTCTGCTTGTCTGCTG
BSP TACGAACAAATAGGCAACGAGT TTCGTCCTCATAAGCTCGGTAA
COL1 TGACTGGAAGAGCGGAGAGTA GGGGTTTGGGCTGATGTACC

2.8. M6A-RT-PCR (MeRIP-qPCR) P0286, China) and boiled at 99°C for 5 min. Equal amounts
of protein lysates were subjected to SDS gel electrophoresis
After extraction with TRIzol, the total RNA was used for the and transferred onto polyvinylidene fluoride (PVDF)
m6A-IP-PCR (MeRIP-qPCR). Total RNA (1 μg) was taken membranes (Millipore, IPVH00010, USA). The membranes
out regraded as an input and was reverse transcribed to cDNA were then blocked in Tris-buffered saline Tween-20
instantly. The remaining RNA (20 μg) was equally divided containing 5% non-fat milk at room temperature for 1 h
into RIP and IgG groups. The RNAs of the RIP and IgG and incubated with a primary antibody at 4°C overnight.
groups were immunoprecipitated with 5 μg m6A antibody The membrane was incubated with a secondary antibody
(Synaptic system, 202003, Germany) or anti-IgG (Cell at room temperature for 1 h. Protein immunoreactivity was
Signaling Technology, 2729S, USA) in 500 μL IP buffer
(150 mM NaCl, 0.1% NP-40, 10 mM Tris, pH 7.4, 100 U detected using LI-COR Odyssey Fluorescence Imaging
System (LI-COR Biosciences, Lincoln, NE, USA) and the
RNase inhibitor) at 4°C for 2 h. The liquid was then mixed protein immunoreactive band intensity was measured using
with Pierce™ Protein A/G Magnetic Beads (Thermo Fisher Image-Pro Plus 6.0. The antibodies used were as follows:
Scientific, 88803, USA) and rotated for 2 h at 4°C after the METTL3 (1:1000; Proteintech, 15073-1-AP, USA), WTAP
beads were washed in 1 ml IP buffer twice. Afterward, the
mixture was washed with 1 ml IP buffer 4 times and eluted (1:6000; Proteintech, 60188-1-Ig, USA), ALKBH5 (1:6000;
twice with 50 μL elution buffer (5 mM Tris-HCl pH 7.5, 1 mM Proteintech, 16837-1-AP, USA), RUNX2 (1:1000; Cell
Signaling Technology, 12556, USA), β-actin (1:6000;
EDTA pH 8.0, 0.05% sodium dodecyl sulfate (SDS), 20 mg/ Proteintech, 66009-1-Ig, USA), anti-rabbit IgG (H+L)
ml Proteinase K) for 30 min. Then, the RNA was extracted
with TRIzol and reverse transcribed to cDNA with random (DyLight™ 800 4X PEG Conjugate) (1:10,000; Cell
hexamers. cDNA (2 μL) from the RIP or IgG groups was Signaling Technology, 5151, USA), and anti-mouse IgG
used for qRT-PCR. Relative fold enrichment was calculated (H+L) (DyLight™ 800 4X PEG conjugate) (1:10,000; Cell
Signaling Technology, 5257, USA).
as 2 -ΔΔCt . The primers for MeRIP-qPCR were as follows:
Forward, 5’ to 3’, TGTACCACACAGGTCACGATT; 2.11. Animal experiments
reverse, 5’ to 3’, ATGAGGGGAGAAAATGCCAA.
(1) Calvarial defect model
2.9. RNA stability assays
Eight-week-old SD rats were chosen for the animal
To measure RNA stability, actinomycin D (Act-D; experiments. All animal surgeries were performed under
Sigma, A4262, USA) was added to the BMSCs at 5 μg/ sterile conditions. The rats were anesthetized, and a 10 mm
ml. After being incubated at 37°C for 0 h, 2 h, 4 h, and incision was made along the median line of the heads.
6 h, the BMSCs were collected and RNA was extracted Two calvarial defects with a diameter of 7 mm were made
with TRIzol for qRT-PCR. GAPDH was used as an bilaterally using a circular bit. Then, the β-TCP scaffolds
endogenous control. were implanted carefully into a random side, and the
other side was used as a control. Subsequently, the skin
2.10. Western blot analysis was sutured and the wound was disinfected.
The BMSCs were harvested using RIPA lysis buffer Animal experiments of this study were approved by
(Beyotime, P0013B, China) containing 1% protease and the Ethics Committee of Shanghai Ninth People’s Hospital,
phosphatase inhibitor cocktail (100×) (Thermo Scientific, Shanghai JiaoTong University School of Medicine.
78442, USA) and 1% phenylmethanesulfonyl fluoride (2) Micro-computed tomography (micro-CT) analysis
(PMSF) (100 mM) (Beyotime, ST506, China) followed by
centrifugation at 13,500 × g at 4°C for 15 min. The protein was Two months after the surgery, the SD rats were euthanized,
mixed with SDS-PAGE protein loading buffer (Beyotime, and the skulls were collected. A micro-CT scanning

34 International Journal of Bioprinting (2022)–Volume 8, Issue 2