Page 123 - OR-1-2

Degradation ratio (%) = (W -W )/W × 100% (III) using trypsin (Gibco, USA), fixed in 70% chilled ethanol,
0 N 0
Where W is the initial weight of the material, and W washed, and stained with 0.1 mg/mL propidium iodide
0
N
is the weight after treatment with collagenase II (BS033B, (P422887, Aladdin, China). Cell cycle distribution was
BioSharp, China). 20 determined using the fluorescence-activated cell sorting
Calibur flow cytometer (BD Biosciences, USA). 22
2.4. Preparation of PVAm
2.8. Hemolysis studies
Aqueous PVAm solution (molecular weight = 1,100,
concentration = 10%) was dialyzed using a membrane with Anticoagulated blood from 3-month-old C57BL/6 male
a molecular weight cutoff of <10,000 and passed through a mice was processed to isolate pure erythrocytes, which
syringe with a pore size of 5 μm. The purified PVAm was were then suspended in phosphate-buffered saline (PBS).
then lyophilized and subsequently re-dissolved in distilled The TBM was added to the erythrocyte suspensions, and
water at a concentration of 0.9 mg/mL. 21 the mixture was incubated at 37°C for 180 min. Following
incubation, the supernatants were photographed,
2.5. Slow-release studies and absorbance values were recorded as previously
The TBM loaded with rhodamine B (5 μg/mL; R104960, described. 23
Aladdin, China), fluorescein amidite (FAM)-modified 2.9. Osteogenic differentiation methods
siRNA-negative control (FAM-NC) (100 μM; GenePharma,
China), or PVAm-FAM-NC (1:1 by v/v) was thoroughly To evaluate osteogenic differentiation in hMSC or
washed in deionized water for 30 min. For slow-release ADSC, reverse transcription-polymerase chain reaction
studies, the washed TBM was then immersed in 1 mL (RT-PCR), alkaline phosphatase (ALP) staining, and
deionized water at 4°C (rhodamine B was tested at room alizarin red S (ARS) staining were employed. ALP
temperature) for slow-release studies. The medium was staining was conducted using a BCIP/NBT ALP coloWr
collected at specific time intervals, and the TBM was development kit (C3206, Beyotime Biotechnology,
re-immersed in fresh 1 mL deionized water to continue China), whereas ARS staining was conducted using
the slow-release process. Fluorescence measurements were 0.5% ARS (pH = 4.2; A5533, Sigma-Aldrich, USA). For
24
performed using the SpectraMax Paradigm microplate RT-PCR, total RNA was extracted using the E.Z.N.A. ®
reader (Molecular Devices, USA). Total RNA Kit I (R6834-02, Omega Bio-TEK, USA) and
reverse-transcribed into complementary DNA (cDNA)
2.6. Cell culture
st
®
using the HiScript II 1 Strand cDNA synthesis kit
The hMSCs and ADSCs were cultured in high-glucose (R211-02, Vazyme, China). RT-PCR was then performed
Dulbecco’s modified Eagle medium (DMEM; KGM12800- using the ChamQ Universal SYBR quantitative PCR
500, KeyGEN BioTECH, China) supplemented with Master Mix (Q711-02-AA, Vazyme, China). Primers
10% fetal bovine serum (FBS; BS-1101, OPCEL, China) were purchased from Tsingke, Inc. (China), and their
and 1% streptomycin (0242, Amresco, USA) and 1% sequences can be found in Table 1.
penicillin (0382, Amresco, USA). To induce osteogenic
differentiation, cells (100% density) were cultured in Table 1. The primer sequences for quantitative reverse
osteogenic media consisting of DMEM, 10% FBS, 1% transcription-polymerase chain reaction
penicillin/streptomycin, 1% β-glycerophosphate (G9422, Target gene Sequences (5’→3’)
Sigma-Aldrich, USA), 1% ascorbic acid (A7631, Sigma- Human ALP-Forward GGCCATTGGCACCTGCCTTA
Aldrich, USA), and 1% L-glutamine (G8540, Sigma, USA).
Cells were maintained at 37°C with 5% CO . Human ALP-Reverse ACCCATCCCATCTCCCAGGAA
2 Human RUNX2-Forward TCTGGCCTTCCACTCTCAGT
2.7. Cytotoxicity studies Human RUNX2-Reverse GACTGGCGGGGTGTAAGTAA
Cell viability mediated by the TBM was assessed using the Cell Human GAPDH-Forward CATGGAGAAGGCTGGGGCTC
Counting Kit-8 (CCK-8; C0038, Beyotime Biotechnology Human GAPDH-Reverse CACTGACACGTTGGCAGTGG
Co., Ltd., China) assay. Both hMSCs and ADSCs were seeded Human miR-138-5p CTTGAGCTGGTGTTGTGAATCAG
in 96-well plates and treated with either HAMA or TBM for Mouse Alp-Forward GTTGCCAAGCTGGGAAGAACAC
2 d. The cells were then incubated in DMEM supplemented Mouse Alp-Reverse CCCACCCCGCTATTCCAAAC
with 10% CCK-8 for 4 h, after which 100 μL of the solution
was transferred to measure absorbance at 490 nm using the Mouse Run×2-Forward CGCCCCTCCCTGAACTCT
Sunrise™ microplate reader (TECAN, Switzerland). Mouse Run×2-Reverse TGCCTGCCTGGGATCTGTA
Cell cycle activity in hMSCs was analyzed using flow Mouse Gapdh-Forward TGCACCACCAACTGCTTAG
cytometry. Cells were cultured with TBM for 2 d, digested Mouse Gapdh-Reverse GGATGCAGGGATGATGTTC

Volume 1 Issue 2 (2025) 3 doi: 10.36922/OR025040003