Page 48 - AN-2-3

Advanced Neurology TRPM7 signaling in glioblastoma

with a Superdex 16/60 75 columns (GE Healthcare, USA) protein concentration in the centrifuged supernatant was
with buffer (20 mM Tris, pH 8.0, 200 mM NaCl, 2 mM measured with Pierce BCA Protein Assay Kit (Thermo
2-mercaptoethanol). Samples containing proteins of desired Fisher Scientific, USA). Samples were boiled and 40 µg
molecular weight validated by SDS-PAGE were concentrated protein was loaded into each well of the SDS-PAGE gel. The
and quantified using NanoDrop (Thermo Fisher Scientific, gel was transferred to a 0.2 µm PVDF membrane (Bio-Rad,
USA). The quality of the final protein product was evaluated USA) and blocked using 5% skim milk. Membranes were
by mass spectrometry. incubated in the appropriate primary antibodies overnight
at 4°C: anti-TRPM7 (1:1000, ab85016, Abcam, UK); anti-
2.5. Pull-down assay calcineurin A (1:500, G182-1847; BD Pharmingen, CA);
The pull-down assay was performed using HisPur cobalt anti-phospho-AKT (1:1000, 9271S, CST, USA); anti-AKT
beads according to the manufacturer’s instructions (Thermo (1:1000, 2920S, CST, USA); anti-phospho-ERK (1:1000,
Fisher Scientific, USA). In brief, cells were lysed using 5726S, CST, USA); anti-ERK (1:1000, 4695S, CST, USA);
pull-down lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM anti-GAPDH (1:5000, 2118S, CST, USA); anti-6×His
NaCl, 1% NP-40, 0.25% sodium deoxycholate, and protease (1:1000, Y1010, UBPBio, USA). Following incubation with
inhibitors), and the lysate was incubated with the 6×His- the respective mouse (1:7500, 7076S, CST, USA) or rabbit
calmodulin on a rotator at 4°C overnight. HisPur cobalt (1:10000, 7074S, CST, USA) secondary antibodies, protein
beads were incubated with the pull-down mixture, washed signals were detected using X-ray film (Clonex, CA) after
three times with lysis buffer, and eluted with pull-down incubating blots in enhanced chemiluminescence reagents
lysis buffer containing 150 mM imidazole. All samples were (Bio-Rad, USA). The intensity of each protein band was
subsequently analyzed using Western blot. analyzed using ImageJ.

2.6. Cell viability assay 2.9. Wound healing migration assay
U251 cells were seeded at 3×10 cells/well in 96-well plates A vertical wound was created on the U251 cell layer in
3
and incubated in a medium containing 10 – 80 µM CsA. 12-well plates. Culture medium containing 1% FBS and
After 24 h, the Cell Counting Kit-8 (CCK-8, Dojindo, drug treatments were added to corresponding wells. Four
Japan) solution was added and incubated for 3 h. The representative images at marked locations along the wound
absorbance at 450 nm was determined using a microplate were captured per well using a phase-contrast Olympus
reader (Synergy H1, Biotek, USA). microscope (×10 objective, CKX41) at 0 and 24 h after
treatment. The images were analyzed using ImageJ and the
2.7. Quantitative reverse transcription PCR following formula: Percentage of closure = Gap(T – T )/
(qRT-PCR) GapT ×100%. 24 0

Total RNA was extracted using the PureLink RNA Mini 0
Kit (Thermo Fisher Scientific, USA) and quantified using 2.10. Oris migration assay
Nanodrop (Thermo Fisher Scientific, USA). High-Capacity The Oris migration assay was performed according to the
cDNA Reverse Transcription Kit (Applied Biosystems, manufacturer’s instructions (Platypus Technologies, USA).
USA) was used to synthesize cDNA. cDNA was then In brief, U251 cells were seeded into the Oris 96-well plate
amplified with TRPM7 and GAPDH primers using at 2.5 × 10 cells/mL and a circular wound was created
4
Platinum SYBR Green qPCR SuperMix-UDG with ROX in each well after the removal of the stoppers. A culture
(Thermo Fisher Scientific, USA) in the 7900HT Fast Real- medium containing 1% FBS and drug treatments were
Time PCR System (Applied Biosystems, USA). TRPM7 added to each well. An image was taken for each well using
RT-qPCR primers: CCAGAAACCAAGCGCTTTCC a phase-contrast Olympus microscope (×4 objective) at
(forward); GCCATGACCTGCCTCTTCAT (reverse). 0-, 12-, 24-, and 48-h post-treatment. The percentage of
GAPDH primers: ACTCCACTCACGGCAAATTC closure was analyzed in the same fashion as the wound
(forward); CCAGTAGACTCCACGGACATACT healing assay.
(reverse). The quantity mean of TRPM7 in each sample was
calculated by SDS Software v2.4 (Thermo Fisher Scientific, 2.11. Cell invasion assay
USA) and normalized to the reference gene, GAPDH. The Corning BioCoat Matrigel invasion assay was
conducted according to the manufacturer’s instructions
2.8. Western blot (Corning, USA). In summary, U251 cells were seeded
Cells were resuspended in RIPA buffer (20 mM Tris- into the 24-well Matrigel chambers at 5 × 10 cells/mL in
4
HCl, pH 7.5, 150 mM NaCl, 1% NP-40, 0.5% sodium serum-free DMEM and placed into the companion plate
deoxycholate, 0.1% SDS, protease inhibitors) and the containing a chemoattractant (DMEM with 10% FBS).

Volume 2 Issue 3 (2023) 3 https://doi.org/10.36922/an.334