Page 47 - AN-2-3

Advanced Neurologyurology
Advanced Ne TRPM7 signaling in glioblastoma

GBM cell function. Several publications have shown that 2.3. Co-immunoprecipitation (co-IP)
whereas TRPM7 inhibition in GBM reduced its cell function Overexpression of recombinant mouse Flag-TRPM7
(i.e., migration, invasion, and proliferation) [15-19] , TRPM7 protein in HEK cells was induced by tetracycline
potentiation conversely promoted GBM cell function [20,21] . (1 µL/mL in MilliQ water). After 18 – 24 h, the cells were
Furthermore, our previous studies have also revealed that lysed using co-IP lysis buffer (20 mM Tris-HCl, pH 7.5,
changes in TRPM7 activity affected the phosphorylation of 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% NP-40,
proteins in the PI3K/AKT and MEK/ERK pathways [16,20] . 0.25% sodium deoxycholate, protease inhibitors: 1 µg/mL
Nonetheless, there needs to be a higher level of granularity pepstatin A, 5 µg/mL leupeptin, 2 µg/mL aprotinin, 1 mM
in our understanding of the TRPM7 signaling pathway in sodium orthovanadate, 0.1 mM PMSF, 10 mM NaF). After
GBM before TRPM7 can be pursued as a drug target for centrifuging at 13,000 rpm, the protein concentration of
future clinical application. the supernatant was determined using Pierce BCA Protein
Previous proteomic analysis data from our laboratory Assay Kit (Thermo Fisher Scientific, USA). Anti-Flag
showed a change in the expression of the calcium-dependent antibody (F3165, Sigma-Aldrich, USA) was added to the
Ser/Thr phosphatase, calcineurin, following pharmacological protein lysate and incubated on a rotator overnight at 4°C.
inhibition of TRPM7 . Interestingly, inhibiting calcineurin Protein A/G agarose beads (sc2003, Santa Cruz, USA)
[22]
has also been shown to reduce GBM cell function [23,24] . were then added and incubated for 1 – 3 h. The beads
However, it is unclear (1) if calcineurin and TRPM7 interact were washed three times with lysis buffer. An antibody-
in GBM, and (2) whether calcineurin and TRPM7 act within free negative control was run alongside the experimental
the same pathway to regulate GBM cell function. In this samples. All samples were subsequently analyzed using
study, we demonstrated the interaction between TRPM7 Western blot.
and calcineurin proteins using co-immunoprecipitation
and pull-down assays. Furthermore, inhibiting calcineurin 2.4. His-tagged protein synthesis and purification
upregulated TRPM7 protein and mRNA expression levels Human calmodulin (CALM1) cDNA was
in the human GBM cell line U251. Finally, following amplified using PCR with the following primers:
pharmacological potentiation of TRPM7 activity in U251, ATGGCTGATCAGCTGACCGAA (forward),
enhancement in cell migration and invasion was prevented TTTTGCAGTCATCATCTGTACG (reverse). The product
by inhibition of calcineurin, thus suggesting that calcineurin was inserted into a pET28-BIOH vector using the In-Fusion
is a downstream target of TRPM7 signaling. HD EcoDry Cloning Kit (Takara, Japan) and transformed
into Escherichia coli DH5α cells by heat shock. DNA was
2. Materials and methods then isolated using the QIAprep Spin Miniprep Kit (Qiagen,
2.1. Cell culture Germany) and sequenced. Plasmids were transformed into
E. coli BL21 by heat shock and 1 mM IPTG (BioShop, CA)
The human GBM cell line U251 was obtained from the was used to induce protein overexpression. The bacterial
American Type Culture Collection (Manassas, VA, USA) broth was centrifuged at 6,000 rpm at 4°C and the pellet was
and maintained with Dulbecco’s Modified Eagle Medium sonicated in equilibrium buffer (20 mM Tris, 150 mM NaCl,
(DMEM, Sigma-Aldrich) containing 10% heat-inactivated pH 8.0, 2 mM 2-mercaptoethanol). The supernatant after
fetal bovine serum (FBS, Wisent, CA) and 100 U/mL centrifugation at 12,000 rpm was incubated with Ni-NTA
penicillin-streptomycin (Gibco, CA). Stably transfected agarose beads (Qiagen, Germany). The beads were loaded
Flag-TRPM7 human embryonic kidney (HEK293) cells onto the column and washed using equilibrium buffer
were maintained with Minimum Essential Medium (MEM, containing 20 mM and then 30 mM imidazole (Bioshop,
Sigma-Aldrich, USA) containing 10% heat-inactivated FBS CA), at ×10 the resin volume. Finally, proteins were eluted
and 100 U/mL penicillin-streptomycin. All cell cultures using ×1 resin volume of equilibrium buffer containing 250
were maintained in an incubator at 37°C (5% CO ; 95% mM imidazole. The protein of interest was purified using ion
2
humidified air). exchange chromatography with HiTrap Q HP anion column
(GE Healthcare, USA) with solution A (20 mM Tris, pH 8.0,
2.2. Reagents 2 mM 2-mercaptoethanol) and B (20 mM Tris, pH 8.0, 2

The stock solution of cyclosporine A (CsA, ab120114, mM 2-mercaptoethanol, 1 M NaCl) at a gradient of 0–80%
Abcam, UK) was prepared in DMSO at 100 mM. The stock of buffer B running 10×column volume. After confirming
solution of Naltriben mesylate (Naltriben, 0892, Tocris, using sodium dodecyl-sulfate polyacrylamide gel
UK) was prepared in DMSO at 50 mM. Tetracycline electrophoresis (SDS-PAGE), the eluted samples containing
(87128) and dimethyl sulfoxide (DMSO, 472301) were proteins of the desired molecular weight were carried
obtained from Sigma-Aldrich (USA). to gel filtration chromatography, which was performed

Volume 2 Issue 3 (2023) 2 https://doi.org/10.36922/an.334