Page 134 - GPD-3-3

Gene & Protein in Disease Association of GST1 with lung cancer

resulted in a single undigested 327 bp fragment, while 2.4. Statistical analysis
the AG genotype produced three fragments (327 bp, Allele frequencies of the GSTA1 rs2207950 and SULT1A1
306 bp, and 21 bp), and the GG genotype produced two rs743590 polymorphisms were compared between cases
fragments (306 bp and 21 bp). Figure 2A and B show and controls using contingency Chi-square analysis
representative PAGE images of the different genotypes (95% CI) through JAVASTAT. This analysis aimed to
after RFLP for the two selected variants. Since no specific identify any potential biased distribution of alleles. In
restriction sites were initially found for the two SNVs addition, genotype distribution differences between cases
using NEB Cutter version 2.0 (New England Biolabs, and controls were examined using multivariate logistic
United States), the reverse primer sequences were regression in SNPStats. The level of significance was set
modified to introduce restriction digestion sites for both at P < 0.05. Dominant, co-dominant, and recessive model
SNVs. The primer sequences for the GSTA1 rs2207950 regression analyses were employed to enhance the depth
were as follows: and robustness of the case–control study. Each genetic
Forward: 5’CATCCAGTAACTTAAACCTT 3’ and model was designed based on distinct expectations
Reverse: 5’ACAGGGAGTTGCTGGACAGATGG 3’. regarding the potential genetic effects within the data.
For the SULT1A1 rs743590, the primer sequences
were: 3. Results
Forward: 5’CCAGCTGGCAAACTAAGGAG 3’ and A comparison of allele (A/G) frequencies for rs2207959
Reverse: 5’TATCCATGGGGAGAGGGCTG 3’. revealed no significant difference between smokers with

Figure 1. Genotype-specific expression of GSTA1 and SULT1A1 as described in the GTex database
A B

Figure 2. Restriction digestion of PCR fragments for (A) GSTA1 and (B) SULT1A1. For GSTA1 rs2207950, the AA genotype produces a band of 229 bp, the
AG genotype shows bands at 206 bp, 23 bp, and 229 bp, and the GG genotype produces bands at 206 bp and 23 bp (the 23 bp bands are invisible). The total
fragment size is 229 bp. For SULT1A1 rs 743590, the AA genotype produces a band at 327 bp, the AG genotype shows bands at 327 bp, 306 bp, and 21 bp,
while the GG genotype produces bands at 306 bp and 21 bp (the 21 bp band is invisible). The total fragment size is 327bp.

Volume 3 Issue 3 (2024) 4 doi: 10.36922/gpd.3928