Page 210 - IJB-10-5
P. 210

International Journal of Bioprinting                                     Biomimetic osteochondral scaffold




            to a confocal laser scanning microscopy for fluorescence   and  incubation in  1%  BSA,  samples  were  treated  with
            staining image observation.                        monoclonal antibodies for RUNX2, COL I, or OCN
                                                               (Boster Biological Technology, China) diluted at 1:500
            2.10. Cell viability and proliferation on          and incubated at 4°C overnight. After rinsing with DPBS,
            osteochondral scaffolds                            samples were incubated in a solution of Alexa Fluor
            The rBMSCs suspension (0.2 mL, 5 × 10  cells/mL) was   488-conjugated secondary antibodies diluted at 1:800 for
                                              5
            dropped onto the subchondral and interface layers, and   1 h at 37°C. The samples were then treated with a solution
            rBMSC  microspheres/GelMA  solution  (0.2  mL,  10    of Alexa Fluor 594 phalloidin and DAPI for F-actin and
                                                          3
            microspheres/mL) was dropped onto the cartilage and   nucleus staining. The fluorescence of each sample was
            interface layers. Cell viability was detected by Live/Dead   observed using a confocal laser scanning microscope. To
            staining. Briefly, after 1 and 3 days of cultivation, cell-laden   investigate ALP production, after fixing with 4% PFA for
            scaffolds were rinsed with DPBS and incubated in ethidium
            homodimer-1 (4 μM) and calcein AM (2 μM) for 20 min at   20 min, samples were treated with ALP staining (described
            37°C, where living cells and dead cells were presented with   in Section 2.6). Furthermore, for real-time quantitative
            green and red colors, respectively. ImageJ software was used   polymerase chain reaction (RT-qPCR) analysis, Trizol
            to analyze cell viability. The cell proliferation properties   (Thermo Fisher Scientific, USA) was used to extract total
            were examined using Cell Counting Kit-8 (CCK-8, GlpBio,   RNA. Thereafter, reverse transcription was performed
            USA) after 1, 4, and 7 days of cultivation. Briefly, samples   using a reverse transcription reagent kit (ABM, Canada).
            were incubated in CCK-8 solution at 37°C for 4 h, and   MagicSYBR mixture, ROX, cDNA, and mixed primers
            the absorbance was measured using a microplate reader   were loaded onto a 96-well plate, and RT-qPCR was
            (Synergy HT, Bio-Tek Instruments, USA) at 450 nm.  performed in an Applied Biosystems QuantStudio™ 3 Real-
                                                               Time PCR Instrument (Singapore). The primer sequences
            2.11. Osteogenic differentiation of rat bone marrow   are displayed in Table 1.
            mesenchymal stem cells in osteochondral scaffolds
            Rat bone marrow mesenchymal stem cells (rBMSCs)    2.12. Chondrogenic differentiation of
            seeded on tissue culture plates and cultured with ordinary   osteochondral scaffolds
            culture medium (DMEM with 10% FBS and antibiotics)   After 21 days of cultivation, osteochondral scaffolds
            were  set  as  the  negative  control  group.  After  14  days  of   were  subjected to  staining  of  the  nucleus,  F-actin,  and
            cultivation, osteochondral scaffolds were subjected to   chondrogenic markers (sry-related HMG box protein-9
            staining of the nucleus, F-actin, and osteogenic markers   [SOX9], COL II, and aggrecan [ACAN]). Briefly, after
            (Runt-related transcription factor-2 [RUNX2], collagen   fixation with 4% PFA, permeabilization in 0.2% Triton
            I [COL I], or osteocalcin [OCN]). Briefly, after fixation   X-100, and incubation in 1% BSA, samples were treated
            with 4% PFA, permeabilization in 0.2% Triton X-100,   with  SOX9,  COL  II,  and  ACAN  monoclonal  antibodies


            Table 1. Primers used in real-time quantitative polymerase chain reaction (RT-qPCR) analysis

             Gene                                 Primer (5’ to 3’)                  Sequence (5’ to 3’)
             GAPDH                                   Forward                     ACCACAGTCCATGCCATCAC
                                                     Reverse                     TCCACCACCCTGTTGCTGTA
             RUNX2                                   Forward                     GAACCAAGAAGGCACAGAC
                                                     Reverse                     AATGCGCCCTAAATCACTG
             COL I                                   Forward                    CAAGAAGACATCCCTGAAGTC
                                                     Reverse                     GCATACATCAGGTTTCCACG
             OCN                                     Forward                     CTTTGTGTCCAAGCAGGAG
                                                     Reverse                     CTCCCAGCCATTGATACAG
             SOX9                                    Forward                     CTCTGGAGACTTCTGAACGA
                                                     Reverse                     ACTTGTAATCCGGGTGGTC
             COL II                                  Forward                     AGGAGACAGAGGAGAAGCT
                                                     Reverse                     CTTGAGGACCCTGGATTCC
             ACAN                                    Forward                    CTGACCAGACTGTCAGATACC
                                                     Reverse                     TCCTCACACCAGGAAACTC


            Volume 10 Issue 5 (2024)                       202                                doi: 10.36922/ijb.3229
   205   206   207   208   209   210   211   212   213   214   215