Page 422 - IJB-10-6

International Journal of Bioprinting 3D-bioprinted respiratory disease model

2378584; Invitrogen, USA) was added to each tube before being observed for confluency. Serial dilutions of the viral
incubation at 50°C for 1 h, followed by incubation at 70°C supernatant (n = 3) were created by diluting in MEM.
for 15 min. During this time, 1:10 dilutions of forward and Media was removed from the MDCK cells with a pipette,
backward primers for GAPDH, IL-29, IL-1β, IL-8, and IP- and the cells were washed with basal media. The diluted
10 (Table 1) were created by diluting in nuclease-free water viral supernatant was added to each well in duplicate.
to reach 10 µM. After incubating for 1 h, the viral inoculum was removed
and virus-growing media containing 0.8% agarose was
For qPCR, a master solution was then created for each
primer by combining 10 µL SYBR Green (PowerSYBR added to the cells. The plates were incubated for 72 h. The
agarose overlay was then removed, and 2 mL Coomassie
Green PCR Master Mix, 4367659, Lot 2305638; Applied Blue was added to each well and let stain for 5 min. The
Biosystems, USA), 1 µL forward primer, and 1 µL stain was then removed, and the plaques were counted for
backward primer, multiplied by the number of samples calculating viral titer.
for each primer. After incubation of the tube strip was
complete, the prepared complementary DNA (cDNA) 2.16. Statistical analysis
was diluted by a factor of 1:10. A 96-well plate was then All statistical analysis was carried out using Statistical
prepared for PCR by adding 18 µL of the corresponding Product and Service Solutions analysis software (SPSS
primer master solution and 2 µL of the diluted cDNA to 28). General linear modeling with univariate analysis
each well. PCR was then carried out using a StepOnePlus of variance (ANOVA) was used for analysis, with p <
Real-Time PCR System (Applied Biosystems, USA). The 0.05 considered significant. For studies with n = 3, non-
temperature was originally raised to 95°C for 10 min. parametric Kruskal–Wallis tests with pairwise comparisons
Following that, 50 cycles were carried out starting at 95°C, were used for analysis.
dropping to 55°C for 15 s, before increasing to 72°C for 20 s,
followed by a melt-curve stepping at 0.3℃/min. Relative 3. Results
mRNA expression was normalized to mRNA levels of the 3.1. Rheology
housekeeping gene GAPDH and expressed using the ΔΔCt Rheological analysis of the alginate/gelatin/collagen
method relative to the mock infection. solution demonstrated a relatively consistent decrease in
2.15. Plaque assays viscosity as temperature was increased from 20 to 40°C
Standard plaque assays were carried out to determine the (Figure 1). From this data, the modified Arrhenius model
viral titer throughout the 3D infection period. Briefly, is given as (Equation III):
Madin-Darby Canine Kidney (MDCK) cells, cultured in
Minimum Essential Medium Eagle (MEM; M4655, Lot  2036 19. K 
RNBL9920; Sigma-Aldrich, USA) with 10% FBS and 1× µ T () = 0 091. Pas e⋅ ×   T   (III)
gentamicin sulfate (Lot J721R0K; Biowest, USA) were
plated in 6-well plates and incubated overnight before As gelatin is temperature-sensitive and exists generally
as a liquid at physiological temperatures, this decrease in
Table 1. Primer sequences used in polymerase chain reaction viscosity with increasing temperature is likely due to the
(PCR). melting of gelatin.

Gene Primer direction Primer sequence It is known that being able to print at physiological
temperatures aids in maintaining cell viability by creating
Forward CCTGGCACCCTATGGACACG
GAPDH more favorable biological conditions and that printing with
Backward CAAAGTTGTCATGGATGACC materials with lesser viscosity reduces printing-induced
Forward TCTGCAGCTCTGTGTGAAGG mechanical forces, which may damage cells during the
IL-8 printing process. The results displayed in Figure 1 suggest
28
Backward CAACCCTCTGCACCCAGTTT
that heating the solution to physiological temperatures
Forward GACGCCTTGGAAGAGTCACT (37°C) for printing decreases the printing pressure, thus
IL-29
Backward TGGTCTAGGACGTCCTCCAG reducing shear forces imposed on cells within the bioink.
Forward CGGCATCCAGCTACGAATCT In addition, the comparison of our rheological data in
IL-1β Figure 1 to previous studies indicates that this solution
Backward TCGTGCACATAAGCCTCGTT
has a higher viscosity than alginate/collagen solutions of
Forward CCTGCTTCAAATATTTCCCT similar concentrations but without the addition of gelatin,
IP-10
Backward CCTTCCTGTATGTGTTTGGA suggesting better printability at elevated temperatures. 33

Volume 10 Issue 6 (2024) 414 doi: 10.36922/ijb.3895