Page 438 - v11i4
P. 438

International Journal of Bioprinting                             Osteocytic Wnt7b-PKCδ against microgravity




            2.6. Alkaline phosphatase staining                 2.8. Mineralization assay
            Alkaline  phosphatase (AP)  staining was  performed  as   Mineralized matrix deposition was assessed by ARS
                                                                                           23
            described previously.  Cells were washed with 1× PBS and   staining, as previously described.  Osteocytes and ST2
                             23
            fixed with 3.7% formaldehyde (Chongqing Chuandong   cells were seeded in 24-well plates or PCI3D modules
            Chemical Group, China) for 5 min at room temperature.   and cultured in growth medium for 3 or 7 days,
            Fixed cells were then incubated with staining solution from   respectively. Osteogenic differentiation was then induced
            the BCIP/NBT Alkaline Phosphatase Color Development   by culturing the cells for 14 days in osteogenic medium
            Kit according to the manufacturer’s protocol for 30 min   consisting of growth medium supplemented with 10 mM
            at room temperature. For the PCL and cell-integrated   β-glycerophosphate disodium and 50 μg/mL L-ascorbic
            3D-printed (PCI3D) modules, staining was performed   acid. Cells or modules were fixed with 3.7% formaldehyde
            after 7 and 14 days of culture, with the staining duration   for 3 min and stained with 0.4% ARS solution (pH 4.2) for
            extended to ≥4 h. Stained samples were imaged using a   30 min. Stained samples were imaged under a microscope.
                                                               To quantify mineralization, the ARS stain was eluted with
            standard digital camera.
                                                               10% cetylpyridinium chloride (CPC) for 1 h. The eluent
            2.7. Alkaline phosphatase biochemical activity assay  was collected, and absorbance was measured at 562 nm to
            The AP biochemical activity assay was quantified as   quantify the mineralization status.
            previously described.  Briefly, cells were washed with PBS   2.9. Western blotting
                             23
            and lysed in 300 μL of 10 mM Tris/HCl (pH 7.4) per well.   Western blotting was conducted following standard
            Lysates were scraped, sonicated on ice, and centrifuged   procedures.  Total proteins were extracted by lysing cells
                                                                        24
            at 13,000 rpm for 3 min at 4°C. The  supernatant was   in RIPA lysis buffer containing PMSF and phosphatase
            collected, and AP activity was measured using the AP   inhibitors. Cytoplasmic and nuclear protein fractions
            assay kit following the manufacturer’s instructions.   were isolated using a nuclear and cytoplasmic protein
            Absorbance at 405 nm was recorded using a VarioskanTM   extraction kit. Protein samples (20 µg per lane) were
            LUX multimode microplate reader (Thermo Fisher     separated by 10% SDS-PAGE and transferred onto 0.22
            Scientific, USA).                                  µm polyvinylidene fluoride (PVDF) membranes (Boster




            Table 1. Sequences of primers used for qPCR
                                                          Primer sequence (5’–3’)
             Gene
                                          Forward                                     Reverse
             Gapdh                GCACAGTCAAGGCCGAGAAT                       GCCTTCTCCATGGTGGTGAA
             Wnt3a                CTTAGTGCTCTGCAGCCTGA                      GAGTGCTCAGAGAGGAGTACTGG
             Wnt5a                  TTGGCCACGTTTTTCTCC                        TGGCTGCAGAGAGGCTGT
             Wnt7b                GCCTCATGAACCTTCACAAC                        AACTTAGGTAGCGTGGTCCA
             Alpl                  TTCGCTATCTGCCTTGCCTG                       AGTCTGTGTCTTGCCTGCC
             Runx2                 CCGTGGCCTTCAAGGTTGT                         TTCATAACAGCGGAGGCA
             Col1a1                TCAACCCCGTCTACTTCCCT                     TTCAACAGTCCAAGAACCCCAT
             Bglap                GCCTACAAACGCATCTACGG                       GAGAGAGAGGACAGGGAGGA
             Sp7                   GCCCCCTGGTGTTCTTCATT                       CTTCCCCCTTCTTGGCACTC
             Ibsp                 CAGAGGAGGCAAGCGTCACT                       GCTGTCTGGGTGCCAACACT
             Axin2                TGAGCGGCAGAGCAAGTCCAA                      GGCAGACTCCAATGGGTAGCT
             Pparg             AGCCCTTTACCACAGTTGATTTCTCC                 GCAGGTTCTACTTTGATCGCACTTTG
             Cebpa                TGGACAAGAACAGCAACGAG                        TCACTGGTCAACTCCAGCAC
             Mef2c               AAGCCTCAGCATCAAGTCAGAAC                     GCGTGGTGTGTTGTGGGTATC
             Sost                 GTGCCTCATCTGCCTACTTGTG                    CGGTTCATGGTCTGGTTGTTCTC
             Tnfa               CACGCTCTTCTGTCTACTGAACTTC                   CTTGGTGGTTTGTGAGTGTGAGG
             Il1b                 TCGCAGCAGCACATCAACAAG                     TCCACGGGAAAGACACAGGTAG
             Il8                  GAGCACTCCATAAGGCACAAA                        ATGGTTCCTTCCGGTGGT


            Volume 11 Issue 4 (2025)                       430                            doi: 10.36922/IJB025240238
   433   434   435   436   437   438   439   440   441   442   443