Page 92 - IMO-2-1

Innovative Medicines & Omics Economical method for titering viral vectors

been made, alongside some setbacks. Despite these early TRIzol reagent (catalog number 15596026) was purchased
challenges, intensive research efforts have continued, from Thermo Fisher Scientific, Australia.
leading to the approval of several viral vector-based
therapies, with many others currently in late-stage clinical 2.1.4. Cells and cell culture
trials. 6 Human embryonic kidney 293 cells, 0.45 µm Nalgene
Lentiviral vectors are generated by transfecting filters, and OptiMEM 1 Reduced Serum Medium were
human embryonic kidney 293 (HEK293T) cells with the purchased from Merck Life Science Pty Ltd, Australia.
transfer plasmid and packaging plasmids. A critical step Fetal calf serum (FCS), Dulbecco’s Modification of
in the lentiviral vector production process is calculating Eagles Medium (DMEM), and penicillin/streptomycin
an accurate and reproducible vector titer, which can be (pen/strep) were purchased from Thermo Fisher Scientific,
time-consuming. Several methods for measuring viral Australia.
vector titer have been described, including enzyme- CF2 CellSTACK 2 chambers (catalog number CLS3310)
linked immunosorbent assays to measure the p24 antigen were purchased from Merck Life Science Pty Ltd, Australia.
(a protein component of HIV), reverse transcriptase
activity, dot blotting, fluorescence-activated cell sorting 2.1.5. Molecular reagents
(FACS), and quantitative polymerase chain reaction PowerUp SYBR Green Master Mix was purchased from
(qPCR), which are among the most accurate methods. Thermo Fisher Scientific, Australia.
7,8
FACS analysis is not suitable for vectors lacking fluorescent
reporter genes, making qPCR the most universally reliable DNase/RNase free water, Micro Amp Fast Optical
7
method for quantifying lentiviral titer. For commercial 96-well reaction plates, Woodchuck Hepatitis Virus Post-
6,9
viability, large-scale production of the vector at high titers transcriptional Regulatory Element (WPRE) forward
is essential. However, many commercially available qPCR- primer (AGCTCCTTTCCGGGACTTTC), and WPRE
based kits for titering lentiviral vectors are prohibitively reverse primer (AGCCATGGAAAGGACGTCAG) were
expensive. Here, we present the development of a rapid, purchased from Thermo Fisher, United States.
cost-effective, efficient, and accurate method of lentiviral
vector titering. We utilized the third-generation lentiviral 2.1.6. Equipment
vector pRRL.sin.cPPT.LSP.IRES.mVenus.WPRE and Tangential Flow System (TFF; catalog number OS100T12)
compared the results from our TRIzol-based qPCR was purchased from Pall Corporation, Australia.
method with those obtained using the commonly used Centrifuge (catalog number Eppendorf 5424R) was
commercial qPCR Lentivirus Titer Kit (catalog number purchased from Eppendorf South Pacific Pty Ltd, Australia.
LV900; Applied Biological Materials [ABM] Inc., Canada).
The TRIzol-based method described is not only rapid and Nanodrop One and QuantStudio 6 Flex Real-Time PCR
cost-effective but also provides titer calculations that are as systems were purchased from Thermo Fisher Scientific,
accurate as those generated by the ABM kit. Australia.

2. Materials and methods 2.2. Lentiviral vector production
2.1. Materials The third-generation lentiviral vector, pRRLSIN.cPPT.
PGK-GFP.WPRE, was produced as follows:
2.1.1. Plasmids
The calcium phosphate (CaPO ) precipitation method
4
pRRLSIN.cPPT.PGK-GFP.WPRE, pMDLg/pRRE, pRSV/ was used for the transient transfection and packaging of
REV, and pMD. 2/VSV.G were purchased from Addgene, the four lentiviral plasmids in 293T cells.
United States. (i) Day 1 – Preparation for transfection: 293T cells were
split in DMEM (180 mL) containing 10% FCS and
2.1.2. Commercial kit
1% pen/strep at a density of 6.0×10 cells per CF2
7
Applied Biological Materials Inc qPCR Lentivirus Titer Kit CellSTACK two chambers
(catalog number LV900, Canada) was utilized in this study. (ii) Day 2 – Transfection: The medium on the 293T cells
was changed to OptiMEM 1 (180 mL) containing
2.1.3. Chemicals 4% FCS. The transfection reagents (tubes 1 and 2)
All chemicals and solutions, such as ethanol, were used were prepared as shown in Table 1. The contents
in their pure form and were purchased from Merck Life of tube 2 were slowly mixed into tube 1, and the
Science Pty Ltd, Australia. mixture was left at room temperature for 30 min to

Volume 2 Issue 1 (2025) 86 doi: 10.36922/imo.6552