Page 105 - OR-1-1

until it turned milky white, incubated at 4°C for 10 min, and 2.5.4. Flow cytometry
then centrifuged at 12,000 ×g at 4°C for 15 min. The upper The harvested cells were first centrifuged, and the
aqueous phase was carefully transferred into a new 1.5 mL supernatant was discarded. The cells were then washed once
tube. Isopropanol was added to the sample in a 1:1 ratio, and with PBS, and the wash supernatant was also discarded.
the mixture was inverted 10 times before being incubated at The cells were resuspended in PBS and mixed thoroughly.
4°C for 10 min. The sample was then centrifuged at 12,000 Approximately 1 × 10⁶ cells were transferred to a centrifuge
× g at 4°C for 10 min, and the supernatant was discarded. tube and incubated with 100 μL of primary antibodies
The pellet was washed with 1 mL of DEPC water containing against Col II and ACAN for 60 min. After incubation, the
75% (v/v) ethanol and centrifuged at 7,500 × g at 4°C for cells were centrifuged, and the supernatant was discarded.
5 min. After discarding the supernatant, the tube was The pellet was washed again with PBS and then incubated
inverted onto a paper towel and allowed to dry for 10 min. with 100 μL of Alexa Fluor 594 secondary antibody for
Finally, the pellet was resuspended in 10 μL of DEPC water. 30 min. Following another round of centrifugation and
A 2 μL sample was loaded onto a Cytation 5 microplate for PBS washing, the cells were resuspended in 200 μL of
RNA concentration measurement, with 2 μL of DEPC water PBS and prepared for flow cytometric analysis. Data were
used as the control. A reverse transcription kit was used subsequently analyzed using FlowJo software.
to prepare the cDNA template. Fluorescent PCR kits were
employed for reverse transcription, and the Ct values for 2.6. Inflammation simulation
each gene were obtained using a fluorescence quantitative Following stabilization of the cellular microenvironment, on
PCR instrument. The ΔCt values of the target gene (Col II, day 4, 10 ng/mL of IL-1β was added to the growth medium,
ACAN) in each group (2D; 2D + microfluidics; 3D) were as described in previous studies. On day 7 (Figure 3A),
18
calculated as follows:
post-cell extraction, TUNEL staining, Alcian blue-safranin
ΔCt = Ct (target gene) - Ct (GAPDH) (II) staining, SO/FG staining, and immunofluorescence staining
The reference used for each target gene is defined as were performed to validate inflammation induction.
follows: 2.6.1. TUNEL staining
ΔΔCt = ΔCt (2D; 2D + microfluidics; 3D) After gently shaking the slides to remove excess liquid, a
- ΔCt (control) (III) hydrophobic barrier pen was used to draw circles around
Expression level = 2 -ΔΔCt (IV) evenly distributed cells on the cover glass to prevent
antibody leakage. Each sample was then immersed in
The process was repeated 3 times to ensure the
consistency and reliability of the results. The average value a permeabilization solution and incubated at room
temperature for 5 min to facilitate permeabilization. The
of the three independent experiments was then calculated samples were washed 3 times with phosphate-buffered
to obtain a more accurate representation of the gene saline (PBS), each wash lasting 5 min. After removing
expression levels across different conditions. This repetition the excess liquid, the buffer was added within the circles
helps to minimize experimental errors and ensures that the to cover the tissue and incubated at room temperature for
results are statistically robust (Table 1).
10 min. An appropriate amount of TDT enzyme, dUTP,
and buffer from the TUNEL kit was mixed in a 1:5:50 ratio
Table 1. Primer name and corresponding sequence based on the number of slides, and the mixture was applied
Primer name Primer sequence to the cells within the circles. The slides were incubated at
SOX9-F CAGCCCCTTCAACCTTCCTC 37°C for 1 h. Following incubation, the slides were washed
SOX9-R TGATGGTCAGCGTAGTCGTATT 3 times on a shaking platform in PBS (pH 7.4) for 5 min each.
To block non-specific binding, 3% bovine serum albumin
ACAN-F CCTGCTACTTCATCGACCCC in buffer was applied within the circles and incubated at
ACCAN-R AGATGCTGTTGACTCGAACCT room temperature for 30 min. After gently removing the
Col IIA1-F CAGGATGCCCGAAAATTAGGG blocking solution, the primary antibody, diluted with PBS,
Col IIA1-R ACCACGATCACCTCTGGGT was applied to the slides. The slides were placed flat in a
MMP13-F CTTTGGCTTAGAGGTGACTGG humidified box and incubated overnight at 4°C. A small
MMP13-R AGGCACTCCACATCTTGGTTT amount of water was added to the humidified box to
Adamts5-F CCCAGGATAAAACCAGGCAG prevent the evaporation of the antibody. After overnight
incubation, the slides were washed 3 times with PBS
Adamts5-R CGGCCAAGGGTTGTAAATGG (pH 7.4) on a shaking platform, each wash lasting 5 min.
GAPDH-F GTGAAGGTCGGTGTGAACGG The excess liquid was briefly shaken off, and a secondary
GAPDH-R TCCTGGAAGATGGTGATGGG antibody specific to the species of the primary antibody was

Volume 1 Issue 1 (2025) 6 doi: 10.36922/or.8461