Page 101 - AN-3-3

Advanced Neurology Proteomic analysis of microglia exosomes

inducible nitric oxide synthase (iNOS), arginase (Arg), 2.5. Isolation of RNA and quantitative polymerase
programmed cell death 6-interacting protein (Alix), heat chain reaction (qPCR)
shock protein 70 (HSP70), Flotillin-1, and CD9. The Total RNA was extracted using TRIzol reagent (Accurate
primary antibodies were purchased from Cell Signaling Biotechnology, China) according to the standard protocol.
Biotechnology (UK), and antibodies against GAPDH Briefly, microglia of different phenotypes were lysed in
were obtained from Bioworld Technology (USA). On 1 mL of TRIzol reagent, then extracted with chloroform and
the subsequent day, the membranes were washed 3 times precipitated with isopropyl alcohol. The RNA precipitate
with 0.1% TBST for 10 min each and then incubated with was then eluted with 70% ethanol and resuspended in
horseradish peroxidase-conjugated secondary antibodies. DEPC-treated water. Reverse transcription into cDNA
After three additional washes with TBST, protein bands was performed, followed by quantitative real-time reverse
were visualized by an excellent chemiluminescent substrate transcriptase-polymerase chain reaction (RT-PCR)
detection kit and detected using the Gel-Pro system (Tanon using the Roche LightCycler96 PCR instrument (Roche,
Technologies, China). Finally, band intensity analysis was Sweden) and a SYBR Green Kit (Vazyme, China). Relative
performed using ImageJ software (ImageJ 1.5, National gene expression levels were quantified and normalized to
Institutes of Health, USA).
GAPDH. The specific primers used in this study are listed
2.4. Immunofluorescence staining below.
CD86, F: GACCGTTGTGTGTGTTCTGG, R: GATGAG
The mice were deeply anesthetized and underwent
transcardiac perfusion with PBS, followed by 4% CAGCATCACAAGGA;
paraformaldehyde (PFA). The brains were carefully dissected TNF-α, F: CAAGGGACAAGGCTGCCCCG, R: GCAGG
and immersed in 4% PFA for further fixation. Following GGCTCTTGACGGCAG;
dehydration, the brains were sectioned into 20-μm coronal iNOS, F: CAGCTGGGCTGTACAAACCTT, R: CATTGG
slices using a microtome and preserved in cryoprotectant at AAGTGAAGCGTTTCG;
−80°C for further experiments. The brain tissues and primary
cells were fixed for 15 min in 4% PFA at room temperature. Arg, F: CTCCAAGCCAAAGTCCTTAGAG, R: AGGAG
They were then rinsed with PBS and permeabilized with 0.25% CTGTCATTAGGGACATC;
Triton X-100 for 20 min. Subsequently, the samples were CD206, F: TTCGGTGGACTGTGGACGAGCA, R: ATAA
blocked with a blocking buffer containing 2% bovine serum GCCACCTGCCACTCCGGT;
albumin in 1 × PBS for 60 min. Primary antibodies against
Iba1 (Abcam, USA), iNOS (Cell Signaling Biotechnology, YM-1, F: GGGCATACCTTTATCCTGAG, R: CCACT
UK), Arg (Cell Signaling Biotechnology, UK), and NeuN GAAGTCATCCATGTC;
(Millipore, USA) were incubated with the samples overnight GAPDH, F: GCCAAGGCTGTGGGCAAGGT, R: TCTCC
at 4°C. The following day, sections and cells were treated with AGGCGGCACGTCAGA.
secondary antibodies for 2 h, and the nuclei were stained
with DAPI (5 g/mL; Bioworld Technology, USA) for an 2.6. OGD/R model and cell viability assays
additional 15 min. The resultant images were captured using Primary neurons were seeded in a 24- or 96-well plate and
an Olympus FV3000 fluorescence microscope (Olympus, subsequently exposed to a hypoxic incubator (5% CO , 95%
2
Japan). N , 37°C) in glucose-free DMEM for 30 min. Following
2
To evaluate apoptosis in neurons, we employed TdT- this, the cells underwent two washes with PBS, were then
mediated dUTP nick end labeling (TUNEL) and Calcein treated with different phenotypes of microglial-conditioned
AM/PI staining. Viable neurons were labeled with Calcein medium, and were further incubated for 12 h in a regular
AM (green fluorescence), while apoptotic neurons were incubator (5% CO , 95% O , 37°C). For cell viability assays,
2
2
labeled with PI (red fluorescence). Following stimulation 10 μl of CCK8 solution (MedChemExpress, USA) was
of primary cortical neurons with the supernatant from added to each well of the 96-well plate and maintained at
different primary microglia after OGD/R, the cells were 37°C. Finally, the absorbance at 450 nm was determined
subjected to Calcein-AM and PI staining for 15 min or using a microplate reader (Tecan Trading AG, Switzerland).
a TUNEL assay for 2 h, according to the manufacturer’s
instructions (Vazyme, China). Subsequently, images were 2.7. Transient middle cerebral artery occlusion and
captured using a fluorescence camera (Olympus FV3000, infarct volume evaluation
Japan) to distinguish between living and apoptotic cells. All animal procedures were carried out in strict accordance
The mean fluorescence intensity was analyzed using with the regulations set by the Animal Care and Use
ImageJ software. Committee of Nanjing University. Male C57BL/6J mice,

Volume 3 Issue 3 (2024) 3 doi: 10.36922/an.3166