Page 116 - GPD-3-2

Gene & Protein in Disease The effect of myostatin on muscle-related miRNAs

Table 1. Oligonucleotide sequences in this study empty vector, pX601-sgMSTN1, or pX601-sgMSTN2
utilizing TurboFect transfection reagent. These groups
Name Oligonucleotide sequence (5’ – 3’) were designated as the control group (CN), the sgMSTN1
sgRNA1-MSTN F: acctCATGCTTTAACACTGCCTA experimental group (sgMSTN1), and the sgMSTN2
R: aaacTAGGCAGTGTTAAAGCATG experimental group (sgMSTN2), respectively. After 48 h,
sgRNA2-MSTN F: acctGAGGAAATGAAAGCGATTCTCC puromycin was added at a concentration of 2 μg/mL to
R: aaacGGAGAATCGCTTTCATTTCCTC completely eliminate cells in the control group. Following
sgRNA1-MSTN-test F: AATGCATGTACTTGGAGACA resistance screening, the surviving cells were transferred
(520 bp-184/336) R: AGTCCTTGCCTTGGTGGTAT to 96-well plates to establish monoclonal cell lines. The
sgRNA2-MSTN-test F: GTCACTTAAGCATAAGCTAC growth characteristics of monoclonal cells in each well
were observed for 7–14 days, and cells displaying desirable
(533 bp-175/358) R: GTGATAAACCTGGTAGCCTC growth characteristics were selected and transferred to
hPGK-puro (BamHI/ F: ggatccATGTCGACAGGGACAGCAGAGATC 24-well plates for further expansion. Genomic DNA was
EcoRI -1121bp) R: gaattcATGTGCCTACAGCTGCCTTGTAAG extracted from each monoclonal cell line using a genomic
DNA extraction kit, followed by PCR amplification
chain reaction (PCR)-amplified product of the puromycin using the identification primers sgRNA1-MSTN-Test
resistance gene and the pX601 vector were then digested and sgRNA2-MSTN-Test. The gene-knockout C2C12
with BamH I and EcoR I endonucleases. The digestion monoclonal cell lines were confirmed by sequencing the
products were ligated and subsequently transformed into PCR products using upstream primers.
DH5α competent cells, which were inoculated on an LB 2.4. Identification of T7E I endonuclease
plate with ampicillin and cultured overnight at 37°C.
Monoclonal bacteria were selected and sequenced, and First, genome DNA was extracted from different groups
the plasmid with the correct clone was extracted. The final of C2C12 cells 48 h post-transfection. Subsequently, PCR
plasmid was named pX601-puro. amplification of the intracellular Mstn gene was performed
using identification primers sgRNA1-MSTN-Test and
For the sgRNA-MSTN construction, 100 μM sgRNA-
MSTN-F/R were mixed in equal amounts for annealing. sgRNA2-MSTN-test. The resulting target fragments were
recovered using a 1% agarose gel containing a nucleic acid
Two micrograms of pX601-puro were digested with
Bsa I endonuclease at 37°C. The digested products were dye after electrophoresis. The recovered DNA sequence
detected using agarose gel electrophoresis, and the linear was annealed at 95°C for five minutes, followed by gradual
carrier pX601-puro was recovered using a gel extraction cooling from 95°C to 85°C at a rate of 2°C/s, then from
kit. The recovered pX601-puro and the annealed sgRNAs 85°C to 25°C at a rate of 0.1°C/s, and finally, the reaction
were subsequently ligated by T4 DNA ligase. The ligation was stopped at 4°C. Following annealing, 0.5 μL of T7E I
mixture was transformed into DH5α competent cells, endonuclease was added, and the mixture was incubated
inoculated onto an LB plate with ampicillin, and cultured at 37°C for 30 min. Subsequently, polyacrylamide gel
overnight at 37°C. Five colonies were selected, colony electrophoresis was performed to examine the digestion.
PCR screened, and then cultured. The plasmid DNA was The gel was then stained with SYBR Green staining
extracted and sequenced using pX601 universal primers. solution for 1 h, and images were captured using a gel
The sequencing results were compared with the designed imaging system.
sequences to confirm the correct insertion of sgRNA. Image J quantitative software was used to calculate the
Large-scale plasmid extraction was performed using the indel rate using Equation I:
plasmid extraction kit. The concentration of the extracted
plasmids pX601-puro-sgRNA-MSTN1 and pX601-puro- Indel rate 100%= ×− ( 1 (b c)/(a b c)− + + + ) (I)
sgRNA-MSTN12 (abbreviated pX601-sgMSTN1 and
pX601-sgMSTN2, respectively) was diluted to 1 μg/μL for Where a and b represent the gray values of the new strip
later use. generated by cutting, and c represents the gray value of the
uncut strip.
2.3.1. Cell culture, transfection, and screening
2.5. Real-time PCR analysis
The C2C12 cells were cultured in DMEM containing
10% FBS at 37°C with 5% CO . Before transfection, Different groups of C2C12 cells were collected, and total
2
the C2C12 cells were seeded into 6-well plates at a RNA was extracted using the TRIzol reagent. The RNA
concentration of 2 × 10 /mL. Upon reaching 70% concentrations were determined using a NanoDrop
5
confluency, the cells were transfected with either pX601 ND-1000 spectrophotometer. Subsequently, miRNAs

Volume 3 Issue 2 (2024) 3 doi: 10.36922/gpd.2991