Page 117 - GPD-3-2

Gene & Protein in Disease The effect of myostatin on muscle-related miRNAs

were converted into cDNA from 1 μg of total RNA using GAPDH primary antibody diluted in 3% BSA (1:1000) at
the HiScript II 1 Strand cDNA Synthesis Kit according 4°C. Subsequently, the membrane was washed three times
st
to the manufacturer’s instructions. Real-time PCR using tris-buffered saline with 0.1% Tween 20 detergent
®
was performed using an Applied Biosystems 7500 Fast (TBST). Subsequently, the membrane was exposed to HRP-
Real-Time PCR Cycler (Applied Biosystems, USA) and coupled goat anti-mouse secondary antibody (1:2000) at
amplified using the TB Green Fast qPCR Mix following room temperature for 1 h. Finally, the resulting image was
®
the manufacturer’s instructions. The thermocycling captured after washing the membrane three times with
conditions were as follows: predenaturation at 95°C for TBST.
30 s, followed by 40 cycles of denaturation at 95°C for 5 s,
and annealing at 60°C for 30 s. The gene expression level 2.7. Evaluation of proliferative characteristics of
22
was calculated using the formula 2 -△△Ct to determine the C2C12 cells using CCK-8
relative expression level of the target gene, with U6 snRNA Suspensions of C2C12 cells from different groups were
serving as the internal reference gene. The primers for real- transferred into 96-well plates at a density of 5 × 10 cells/
3
time PCR are listed in Table 2. well. After 48 h of incubation, the culture medium was
2.6. Western blot analysis replaced. Subsequently, 10 μL of CCK-8 solution was
added to each well, and the 96-well plates were further
First, the total protein was extracted from C2C12 cells in incubated for 2 h. The absorbance at 450 nm was then
different groups, and then, the protein concentration was measured using an enzyme-linked immunoassay.
determined using the BCA method. The specific protocol
followed the instructions provided with the BCA protein 2.8. Measurement of the growth cycle of C2C12 cells
quantitative detection kit. Samples with known protein using propidium iodide
concentrations were supplemented with 5× loading buffer Different groups of C2C12 cells (2 × 10 cells) were digested
6
and boiled for 10 min to ensure thorough denaturation of using the pancreatic enzyme (200 g) and centrifuged for
the protein samples. Subsequently, 30 μg of total protein 5 min to collect the cell pellet. The cells were then washed
samples were loaded into each well, and electrophoresis twice with pre-cooled PBS. The cell pellets were suspended
was performed at 110 V. Before protein transfer, the in 0.5 mL of PBS, followed by the addition of 1.2 mL of pre-
polyvinylidene fluoride (PVDF) membrane was pre-soaked
in methanol, and then, the electrophoretically isolated cooled pure ethanol. The suspended cells were gently mixed
proteins were transferred onto the PVDF membrane using to prevent cell aggregation and then fixed at 4°C for 18 h.
an electric current. The membrane was then treated with After fixation, the cells were washed once with 1 mL of PBS,
5% bovine serum albumin (BSA) at room temperature centrifuged to obtain a cell pellet, and then, 100 μL of RNaseA
for 1 h, followed by overnight incubation with MSTN/ and 400 μL of PI were added to the mixture. The samples
were incubated at 37°C for 30 min in the dark. The stained
Table 2. List of primers for real‑time PCR samples were analyzed using flow cytometry, and the results
were analyzed using the cell cycle software ModFit 3.
Name Oligonucleotide sequence (5’ – 3’)
miR-23a F: TTGGCCGGCTGGGGTTCCTG 2.9. Statistical analysis
R: AGGTCAGTTGGAAATCCCTG Statistical analysis and visualization of experimental results
miR-1 F: CGAACTACCTGCTTGGGGCA were performed using GraphPad Prism 6. Data from each
R: CTGGCCTGAAATACACACTT group were collected from three independent replicates.
miR-133a F: CCCTGCTCTGGCTGGTCAAAC Independent t-tests were used to compare significant
R: TTGCCAGCCCTGCTGTAGCTGG differences between groups. A P-value between 0.01 and 0.05
was considered indicative of a significant difference, while
miR-206 F: CCAGGCCACATGCTTCTTTA a P < 0.01 was considered a highly significant difference.
R: CCAAAACCACACACTTCCTTAC
miR-431 F: CGTCCTGCGAGGTGTCTTGC 3. Results
R: GATGTCGTCTTGCGAGAAGC 3.1. Construction of pX601-puro-sgRNA vectors
miR-486 F: CAGCCAGCTCTGATCTCGCC The vector construction method is illustrated in Figure 1A.
R: TGGCTTGTTCCCCGTTGTCTC First, the puro resistance gene containing the hPGK
U6 snRNA F: ATTGGAACGATACAGAGAAG promoter was inserted into the pX601 linear vector
R: GGAACGCTTCACGAATTTG to construct the pX601-puro plasmid. Subsequently,
Abbreviation: PCR: Polymerase chain reaction. sgRNA1-MSTN and sgRNA2-MSTN were inserted

Volume 3 Issue 2 (2024) 4 doi: 10.36922/gpd.2991