Page 472 - IJB-10-4

International Journal of Bioprinting 3D-bioprinted peripheral nerve scaffold

Table 2. Primer sequences used to amplify the targeted genes received an intraperitoneal injection of 105 units of
penicillin. All rats were euthanized 8 weeks post-surgery.
Gene Primers Animal care and use were allowed and strictly adhered to
NGF Forward: GCAAGCGGTCATCATCCCATCC the guidelines set by the researchers’ institution.
Reverse: TCTGTGGCGGTGGTCTTATCCC
BDNF Forward: GACACTTTCGAACACGTGATAG 2.5.1. Regenerative nerve function
Reverse: TACAAGTCTGCGTCCTTATTGT The walking trajectory analysis was conducted 8 weeks
GDNF Forward CTTCCTAGAAGAGAGCGGAATC post-experiment by bilaterally applying black ink to the
Reverse: ATCAGTTCCTCCTTGGTTTCAT hind limbs of the rats to collect their footprints while they
PDGF Forward GTAGGGAGTGAGGATTCTTTGG traversed white paper. On both the experimental (E) and
Reverse: GAATCTCGTAAATGACCGTCCT normal sides (N), we measured the toe spread width (TS),
P0 Forward: CTATCCTGGCTGTGCTGCTCTTC paw length (PL), and intermediate toe spread width (IT).
Reverse: TGGACCTCCCTGTCGGTGTAAAC Additionally, the sciatic nerve function index (SFI) was
42
S100B Forward: AATCAAAGAGCAGGAGGTTGTGGAC calculated as follows:
Reverse: GAACTCGTGGCAGGCAGTAGTAAC
GAPDH Forward: AGATCCCTCCAAAATCAAGTGG SFI = 109 5.( ETS NTSNTS− )/ −383.( EPLNPL NPL− )/ +13 3.( EIT NITNIT− ) − 888.
Reverse: GGCAGAGATGATGACCCTTTT (I)
SFI = 109 5.( ETS NTSNTS− )/ −383.( EPLNPL NPL− )/ +13 3.( EIT NITNIT− ) − 888.
BNGF-1; RayBio, USA). Shortly, the initial cell density was
adjusted to be equal for both 2D and 3D cultures. On day 2.5.2. Electrophysiological analysis
7, the supernatant of the cell cultures was gathered and Electrophysiological analysis was conducted 8 weeks
centrifuged. The collected specimens and provided standards post-surgery to visualize the right sciatic nerve under
were subsequently placed in anti-NGF antibodies-coated anesthesia. A bipolar stimulating electrode was affixed
wells of a 96-well ELISA plate for 2.5 h. After the sequential to the proximal end of the regenerated nerve to deliver
addition of biotinylated antibodies and streptavidin solution, a single electrical signal. Electromyography (EMG)
the 2D and 3D samples were incubated for 1 h and 45 min, was performed using an implanted electrode in the
respectively. Thereafter, 3,3’,5,5’-tetramethylbenzidine gastrocnemius muscle. Recordings were taken of
(TMB) was added to colorize the samples and incubated for different latencies and distances between stimulus ends,
30 min before stopping the reaction with a stop solution. The and measurements were made for both compound
microplate reader was used to promptly assess the OD value muscle action potential (CMAP) and nerve conduction
at a wavelength of 450 nm. velocity (NCV).

2.5. In vivo experiments 2.5.3. Histological examination
Twenty-four Sprague-Dawley (SD) rats (male; specific- For toluidine blue staining, all nerve samples were fixed with
pathogen-free [SPF] grade; 200–250 g) were randomly 4% glutaraldehyde for 48 h and subsequently treated with
assigned to four groups: scSHED group (PCL-hydrogel 2% osmium tetroxide (Sigma-Aldrich, USA). Following
scaffold laden with scSHEDs), PCL Group (PCL- the embedding of the specimens, tuberculosis (TB)
hydrogel scaffold without scSHEDs), hydrogel group staining was conducted. The regenerating sciatic nerve was
(simple hydrogel scaffold), and autograft group (auto- observed under a light microscope, and the myelinated
transplantation). All scaffolds were rolled into a pillar 3 nerve fiber count and the regenerative fiber diameter in the
days after 3D bioprinting. After intraperitoneal injection middle of the nerve were calculated. Immunohistochemical
of sodium pentobarbital (30 mg/kg) for anesthesia, the staining for GAP43 (16971-1-AP; Proteintech, USA),
right sciatic nerve was exposed by incision and isolated. NF-200 (18934-1-AP; Proteintech, USA), and S-100β
A 10 mm nerve defect area was created by clipping the (15146-1-AP; Proteintech, USA) was performed on the
nerve. In the scSHED, PCL, and hydrogel groups, a 10 midsections of the nerve grafts. Antigen retrieval was
mm length scaffold was placed in the nerve defect area performed by subjecting the samples to a heat treatment at
and sutured with a 9-0 nylon suture (Figure 5A). For the 95°C for 20–25 min in a sodium citrate buffer. To prevent
autograft group, the clipped 10 mm nerve was inverted nonspecific binding, 1% BSA was utilized as a blocking
in the defect and sutured with a 9-0 nylon suture. The agent. The tissue sections were then exposed to primary
muscles and skin were sequentially closed with 4-0 nylon antibodies overnight at 4°C, followed by rinsing with PBS
sutures. The rats were housed in a controlled environment and subsequent staining using secondary antibodies at
with a temperature of 20–25℃ and a light/dark cycle room temperature for 1 h. Subsequently, the samples were
of 12 h. Immediately after the operation, all animals rinsed again, stained with 3,3’-diaminobenzidine (DAB),

Volume 10 Issue 4 (2024) 464 doi: 10.36922/ijb.2908