Page 187 - IJB-10-6

International Journal of Bioprinting 3D-printed EVs for nasal septal defects

and a control group. A total of 100 μL serum-free medium, using an ultra-microvolume ultraviolet spectrophotometer
containing 5 × 10 cells, was added to the transwell chamber (KAIAO, China). Reverse transcription to complementary
4
and cultured at 37°C for 24 h. The chamber was washed DNA (cDNA) was performed according to the
with PBS, and 4% paraformaldehyde (Bbiosharp, China) manufacturer’s protocol for the reverse transcription kit
was added for fixation. After wiping the upper chamber, (Vazyme, China). The synthesized cDNA was subjected to
cells at the bottom of the chamber were stained with 0.1% qRT-PCR using a real-time PCR detection system (3 107B-
crystal violet dye solution (Solarbio, Germany) and placed 1612; Roche, Switzerland). Gene expression was normalized
under the microscope for cell migration observations. using glyceraldehyde-3-phosphate dehydrogenase, and the
results were calculated using the 2 −△△ct method. All primer
2.9.4. Cell proliferation assay sequences are listed in Table 1.
Chondrocytes (P3) were seeded into 24-well plates, and
the medium was replaced every two days with DMEM, 2.12. Protein expression analysis
containing 2D EVs, 3D EVs, or blank. Cells were The expression of chondrocyte-specific proteins was
incubated with EdU working solution (Beyotime, China) examined after three days of treatment with different EV
for 3 h; the medium was discarded; cells were fixed with concentrations. RIPA Lysis Buffer (BLT, China) and PMSF
4% paraformaldehyde for 15 min and permeabilized with (Beyotime, China) were added to cells at a ratio of 99:1.
Triton X-100 (Beyotime, China) for 30 min; cells were After 10 min of lysis on ice, the cells were scraped into 1.5
washed again; and EdU reaction solution was added to the mL EP tubes (Corning, USA) and centrifuged to obtain
cells for 30 min at room temperature. Cell proliferation supernatant. A spectrophotometer (KAIAO, China) was
was observed using an inverted fluorescence microscope used to measure and calculate the protein concentration.
(Nikon, Japan). Gel electrophoresis was performed with 12.5% SDS-

2.10. Immunofluorescence PAGE (Epizyme, China), and the gel was transferred to
After seeding 1 × 10 chondrocytes into confocal cell a PVDF membrane. The sample was blocked with 5%
6
culture dishes (WHB, China), EV (5 × 10 , 10 × 10 , and skim milk for 1 h, rinsed with TBST (Servicebio, China)
8
8
20 × 10 EVs/mL) and control groups were set up and three times, and incubated with primary antibodies (anti-
8
incubated for two days in the incubator. Thereafter, 4% col II [Aifang, China], anti-ACAN [Aifang, China], and
paraformaldehyde was added for fixation for 15 min, anti-SOX 9 [Aifang, China]) at 4°C. After washing off
and a blocking solution, containing FBS (Beyotime, the primary antibody with TBST the next day, the goat
China), was added at room temperature for 3 min. The anti-mouse fluorescent secondary antibody (Abcam,
primary antibody Col II was diluted according to the China) were incubated with the samples for 1 h at room
manufacturer’s instructions (Proteintech, China) and temperature, and the images were visualized using a
incubated with the cells at 4°C overnight. After washing chemiluminescent solution (Advantage Biological,
off the primary antibody, fluorescent secondary antibodies China). GAPDH (Aifang, China) was used as a reference
(goat anti-mouse fluorescent secondary antibody) for normalization.
(Proteintech, China)
2.13. In vivo animal experiments
(Proteintech, China) were diluted according to the The use of animals was approved by the 988 Hospital
manufacturer’s instructions and incubated with the cells of the People’s Liberation Army. Twenty-four adult
for 1 h at room temperature in the dark. The secondary
antibodies were washed off before staining with DAPI for Table 1. Sequences of primers used in reverse
10 min in the dark. An inverted fluorescence microscope transcription-quantitative polymerase chain reaction.
(Eclipse-Ti2; Nikon, Japan) was then used to observe
the cells. Gene Primers Sequences (5’–3’)
Col2a1 Forward TTCTCCTTTCTGCCCCTTTGGT
2.11. Reverse transcription-quantitative polymerase
chain reaction (qRT-PCR) Reverse TCTGTGAAGACACCAAGGACTG
Chondrogenic genes ACAN, Col II, and SOX9 were ACAN Forward CAGCCGGACAACTTCTTT
detected using reverse transcription-quantitative Reverse GTGAAGGGTAGGTGGTAATTG
polymerase chain reaction (qRT-PCR). Chondrocytes were SOX9 Forward CTCCGACACCGAGAATACA
harvested according to the manufacturer’s instructions. Reverse CCTCTTCGCTCTCCTTCTT
RNA extraction kit (Karroten, China) was used to extract
total RNA from cells treated with different concentrations GAPDH Forward GTCGGAGTGAACGGATTTG
of EVs. RNA concentration and purity were measured Reverse GTAGACCATGTAGTGGAGGT

Volume 10 Issue 6 (2024) 179 doi: 10.36922/ijb.4118