Page 79 - IJB-8-3

Alshehri, et al.
optimized using the java codon adaptation online of ×1. Gelation occurred within a few minutes at 8 mg/
tool JCat for Halobacterium sp. (strain NRC-1/ATCC mL peptide concentration.
700922/JCM 11081) [48] . The gas vesicle operon from
Halobacterium sp. NRC-1 was amplified from the 2.5. 2D cell culture
genome using polymerase chain reaction (PCR) and HEK293 cells were purchased from ATCC (USA).
cloned with sfGFP via FspAI-HpaI and HpaI-BamHI Cells were cultured in DMEM-HG, supplemented with
using the Gibson Assembly Cloning Kit into pTA963 10% (v/v) fetal bovine serum (FBS) and 1% penicillin/
to generate the pTA963_sfGFP_GVNPs expression streptomycin (PS; Gibco) at 37°C with 5% CO . The
plasmid (Table 1). The construct was validated by cells were subcultured with trypsin at approximately 80%
2
restriction digestion using FspAI, HpaI, and BamHI, confluence. The culture media were changed every 2 –
PCR amplification, and DNA sequencing. Gas vesicles 3 days. Cells at passages 6 – 8 were encapsulated for 3D
containing the vector were transformed into H. volcanii culture and monolayer culture.
H1895 using the PEG/EDTA method [49] .

2.3. Culturing and gas vesicle preparation 2.6. 3D cell culture
HEK293 cells were cultured in 75T flasks and incubated in
The processes for producing and culturing gas vesicles a CO incubator maintained at 37°C with 5% CO . Culture
were performed as previously described [27,30,47] . H. media were replaced every 48 h until the cells reached 80%
2
2
volcanii lawns or floating cells were lysed osmotically
with phosphate-buffered saline (PBS) solution (137 mM confluency. Confluent cells were subcultured, and cells at
NaCl, 2.7 mM KCl, 10 mM sodium phosphate dibasic, passages 6 – 8 were used for the study. For the 3D culture,
and 2 mM potassium phosphate monobasic [pH 7.4]) the peptide was sterilized by exposure to ultraviolet light
containing 10 mM MgSO and 20 μg/mL of DNase I for 30 min. 10,000 cells in ×2 PBS were mixed at a 1:1
4
(Sigma-Aldrich, USA). The cell lysate suspension was ratio with peptide solution and used to prepare 100 μl of
incubated for 1 h at 37°C before overnight centrifugation 3D construct in a 96-well plate without the addition of
at 60× g in a swinging bucket rotor in an Allegra X-15R GVNPs to serve as a control. Different concentrations of
centrifuge (Beckman Coulter, CA, USA) to accelerate GVNPs were obtained by mixing with PBS before adding
floatation of the gas vesicles. Intact gas vesicles were them to form 3D samples. This allowed for the evaluation
collected and re-suspended in PBS, then floated by of the GVNPs effect on cell proliferation.
overnight centrifugation and harvested again. This 2.7. 3D bioprinting
floatation procedure was repeated until a white, milky
suspension of gas vesicles was obtained. Gas vesicle 16 mM of IK peptide was diluted in 1 mL of MilliQ
6
concentration was quantified via NanoDrop 2000 water, mixed well, and sonicated to assure a homogenous
spectrophotometer (Thermo Scientific, Waltham, MA, solution. Eight million cells were suspended in ×1 PBS
USA) by measuring a small sample of gas vesicles broken without GVNPs (control). When printing with GVNPs,
by sonicating for several minutes. the cells were mixed with a ×1 PBS containing GVNPs at
a 300 μg/ml concentration.
2.4. Hydrogel preparation A custom-designed 3D bioprinter along with
The ultrashort peptide IK (Ac-ILVAGK-NH2) used in commercial microfluidic pumps was set up (Figure S1) as
6
this study was synthesized by Bachem AG (Budendorf, described in our previous publications, and a homemade
Switzerland) using solid-phase peptide synthesis and dual coaxial nozzle was used for bioink extrusion [40,41,50] .
purified to above 95% through high-performance liquid Structures were printed in the shape of a rectangular
chromatography. Amino acid and peptide content analyses prism with a length, width, and height of 10 mm, 10 mm,
were performed. The lyophilized peptide powders were and 1.5 mm, respectively. Illustrated figure of the
first dissolved in Milli-Q water and mixed by vortexing printed structure along with the printer setup is shown in
for 30 s to obtain a homogenous solution. Then, ×10 PBS Figure 1. To facilitate imaging, the structure was printed
was added to the peptide solution for a final concentration onto an 18 × 18 mm glass coverslip. The glass coverslip

Table 1. Oligonucleotides used in this study.
Primer 5’‑3’ sequence
pTA.1 GGACCTATTGCGCATATGCACCACCACCACCACCACATGCGCATAATTCAATCGATACGAGTCCCG
pTA.2 AATGCGATGGTCCAGAGGTGCGGCCGCTCTAGAACTAGTGGATCCGATCTGTGAGTGTACACCCC
HpaI-BamHI TGTCTCTTCTTCCTCGTTAACGGTACCGGCGGATTCTCC
FspAI-HpaI GCGGAGAATCCGCCGGTACCGTTAACGAGGAAGAAGAGACAGAGCC

International Journal of Bioprinting (2022)–Volume 8, Issue 3 71