Page 41 - JCTR-10-6

Aminizadeh et al. | Journal of Clinical and Translational Research 2024; 10(6): 348-356 351
molecules to pass through the filter. In the final step, the RNAs the HIIT + MitoQ group exhibited increased MFN1 protein
in the column were eluted from the column using an elution levels compared to the MitoQ group (F = 18.64, p < 0.0001)
buffer and collected in sterile tubes. Then, the concentration (Figure 1B). The gene expression of Opa1, Fis1, and Mfn2 was
and purity of the total extracted RNA were determined using unaffected by either the HIIT + MitoQ or ET + MitoQ regimens
a nanodrop instrument (Nanodrop-KLAB, South Korea). The (Figures 2-4).
cDNA was synthesized from total RNAs while to inhibit the 4. Discussion
RNase enzyme, RNasin (RNase inhibitor) was added to the
reaction mixture (Parstous Biotechnology, Iran). Real-time The results of this study demonstrated that MitoQ alone did
PCR was performed on cDNA with polymerase enzyme, not change the expression of factors involved in mitochondrial
Master Mix Green (Ampliqon, Denmark), and specific primers dynamics, but combination of MitoQ with exercise training led
(Table 1) for the target genes. The 18s rRNA gene was used to the modulation of their expression. Compared to HIIT, ET
as the housekeeping gene. After real-time PCR, Ct values were caused more remarkable changes in gene and protein expression
obtained for both target and reference genes. The ∆Ct value in skeletal muscle. ET significantly increased protein expression
indicates the difference of Ct values between the target gene of DRP1 and MFN1 as well as Opa1 gene expression, while
and the housekeeping gene. The 2 -ΔΔCT formula was used to HIIT only elevated the MFN1 protein level. These findings
determine relative gene expression [31]. suggest that in skeletal muscle, ET affects proteins involved
in both mitochondrial fusion and fission but HIIT affects only
2.6. Statistical analysis factors involved in mitochondrial fusion.
Data are presented as mean ± standard deviation (SD). The increase in MFN2 levels improves muscle performance
After assessing data normality with the Kolmogorov–Smirnov following appropriate intervention. Intermittent aerobic exercise
test, one-way analysis of variance (ANOVA) was used for training improves energy access and reduces oxidative stress
comparisons between groups, followed by Tukey’s post-hoc damage by increasing the expression of MFN2 and OPA1 [32].
test. p < 0.05 was considered significant. In addition, seven rats It seems that when the rats performed ET, due to aerobic
were allocated to each group to achieve the effect size (f) of conditions (in this case, most energy production is produced by
9.044 and a study power of 95% (1-β error probe). mitochondria through aerobic oxidation), the proteins related to
both fusion and fission processes increased in levels and helped
3. Results to improve the dynamics of mitochondria to ensure optimal
mitochondrial capacity, whereas through HIIT, due to the presence
Compared to the control group, the ET groups exhibited of alternating aerobic and anaerobic conditions, metabolic and
significantly increased protein levels of DRP1 (F = 39.09, energy requirements were adjusted accordingly. Mitochondrial
p < 0.0001) and MFN1 (F = 18.64, p = 0.0003), as well dynamics is dependent on metabolic conditions [33]. Due to
as Opa1 gene expression (F = 4.96, p = 0.02) in skeletal this, mitochondria undergo biogenesis and fusion through PGC-
muscle (Figures 1A and B, and Figure 2). Meanwhile, HIIT 1α [34,35] to meet energy requirements, and at the same time,
only increased MFN1 protein levels (F = 18.64, p < 0.0001) the progression towards fission happens to remove damaged
(Figure 1B). MitoQ did not have a significant effect on the gene mitochondria [36]. While our results indicated that MitoQ alone
and protein expression (Figures 1-4). However, its combination did not significantly alter the expression of factors involved in
with both exercise modalities caused significant effects. In the mitochondrial dynamics, it is important to highlight that the
MitoQ-treated groups separately receiving ET or HIIT, DRP1 interplay between exercise training and MitoQ treatment reveals
protein levels increased, when compared to the levels in the critical insights into this relationship. Specifically, our findings
MitoQ group (F = 39.09, p = 0.0006; F = 39.09, p < 0.0001; demonstrated that the combination of exercise training and
respectively) (Figure 1A). Furthermore, we found that only MitoQ led to enhanced expression of certain proteins involved
in mitochondrial dynamics, particularly in the context of ET,
Table 1. Primers’ sequence used in this study which significantly increased DRP1 and MFN1 protein levels
Genes Sequences (5’ – 3’) and Opa1 gene expression [31]. This suggests that while MitoQ
Fis1 Forward: CAAGGAACTGGAGCGGCTCATT may not independently modify mitochondrial dynamics, it has
Reverse: GACACAGCAAGTCCGATGAGT the potential to influence these processes when combined with
Opa1 Forward: CAGCTGGCAGAAGATCTCAAG an exercise regimen. Furthermore, our results indicated that ET
Reverse: CATGAGCAGGATTTTGACACC promotes both mitochondrial fusion and fission, aligning with
Drp1 Forward: CCAGGAATGACCAAGGTCCC metabolic needs, while the effects of HIIT were more central to
Reverse: CCTCGTCCATCAGGTCCAAC mitochondrial fusion, reflecting a subtle understanding of how
Mfn1 Forward: TGGGGAGGTGCTGTCTCGGA varying exercise protocols impact mitochondrial dynamics [32].
Reverse: ACCAATCCCGCTGGGGAGGA It has been reported that in skeletal muscle tissues, a session
Mfn2 Forward: AGCCTGGTGAGTGTGATGTG of aerobic training, despite improving mitochondrial function,
Reverse: CTCCGTGGTGACATCGATCC does not affect mitochondrial dynamics [37]. This is in contrast
B-actin Forward: CCAGAGGCGTACAGGGATAG with the findings of our study, and it may be due to the longer
Reverse: CCAACCGCGAGAAGATGA duration of the training period in our study compared to acute

DOI: http://doi.org/10.36922/jctr.24.00044