Page 98 - GPD-2-1

Gene & Protein in Disease SCN7A is a protective factor in LUAD

2.8. Upstream non-coding RNA analysis GO and KEGG enrichment analyses of the DEGs were

miRGator v3.0 (http://mirgator.kobic.re.kr/ performed. In GO enrichment analysis, the main processes
miRTargetNExpression.html) was used to predict were the extracellular matrix, circulatory system process,
microRNAs (miRNAs) targeting and binding SCN7A . and response to glucocorticoid (Figure 1C), whereas
[19]
starBase (http://starBase.sysu.edu.cn/), a widely used the main pathways in KEGG enrichment analysis were
[20]
database for ncRNA-related analysis , was used to predict complement and coagulation cascades and extracellular
long non-coding RNAs (lncRNAs) binding SCN7A and matrix (ECM)-receptor interaction (Figure 1D).
related LUAD prognosis. 3.2. Prognostic value of key differentially expressed
2.9. Pathway correlation analysis genes
The “GSVA” R package was used for pathway correlation Ion channel-related DEGs, including GRIA1, chloride
assessment, and ssgsea was selected as a parameter in gene intracellular channel 5 (CLIC5), potassium sodium-
set variation analysis (GSVA). Spearman’s correlation was activated channel subfamily T member 2 (KCNT2),
performed to evaluate the association between the selected SCN7A, and CACNA2D2, were identified (Figure 2A).
gene expression and LUAD prognosis. The expression of these five candidate genes in LUAD was
validated using the data in TCGA. The findings revealed that
2.10. Quantitative polymerase chain reaction (qPCR) CLIC5 was overexpressed in tumors but underexpressed in
adjacent normal tissues, whereas GRIA1, KCNT2, SCN7A,
Total RNA was extracted using Trizol. SynScript Ⅲ RT and CACNA2D2 were underexpressed in tumor tissues
®
SuperMix for qPCR (Tsingke, TSK314S) was used for reverse but overexpressed in normal tissues (Figure 2B). Further
transcription. 2 × TSINGKE Master SYBR Green I qPCR Mix-
®
UDG (Tsingke, TSE204) was used for qPCR. The primers used analyses revealed that the overexpression of GRIA1,
were as follows: GAPDHF, CTGGGCTACACTGAGCACC; SCN7A, and CACNA2D2 was associated with favorable
GAPDHR, AAGTGGTCGTTGAGGGCAATG; prognosis (Figure 2C–E), whereas the expression of CLIC5
SCN7AF, GCTTCGTAGCAAGTCCTCCA; SCN7A R, and KCNT2 had no significant effect on LUAD prognosis.
GGGTCCACATCTTCCAAGGG. 3.3. SCN7A as an independent factor for LUAD
prognosis
2.11. Cell counting Kit 8 (CCK8) assay and wound
healing assay Univariate Cox regression analysis confirmed that
After the cell confluency reached 90% in a 6-well plate, it CACNA2D2 (HR = 0.86896, P = 0.00028), GRIA1
was changed to 2 mL serum-free medium for overnight (HR = 0.6111, P = 0.00063), and SCN7A (HR = 0.83379,
culture to deplete the residual serum, and scratches were P = 0.00409) had significant associations with the OS of
made the following morning. A549 cell was scrapped in a LUAD patients (Figure 3A). Further multivariate regression
straight line at 0 h, and images at 0 h, and 48 h were acquired analysis revealed SCN7A (HR = 0.82429, P = 0.03508) to
for analysis. CCK8 assay was performed using CCK8 (YZ- be the only independent predictor of LUAD prognosis
CK04) at day 1, day 2, day 3, and day 4, measuring the (Figure 3B). At the same time, we extracted variables with
absorbance value at 450 nm. significant differences to construct a nomogram prognostic
model to predict the 1-year, 3-year, and 5-year overall
2.12. Statistical analysis survival of LUAD patients (Figure 3C,D). Sankey diagram
also showed that the overexpression of SCN7A in LUAD
Rstudio software (R 4.0.3) was used for data analysis. was associated with better LUAD prognosis (Figure 4A).
P < 0.05 or log-rank P < 0.05 was considered statistically These results showed that SCN7A is a protective factor for
significant.
LUAD prognosis.
3. Results 3.4. Messenger RNA transcription and expression of
3.1. Differentially expressed genes between lung SCN7A protein in lung adenocarcinoma tissues
adenocarcinoma and normal tissues TCGA data analysis indicated that SCN7A mRNA

GSE31552, GSE33532, and GSE103512 contained data transcription and the expression of corresponding proteins
for 35, 40, and 27 LUAD tissues and 39, 10, and 7 normal differed between gender and among different age groups.
tissues, respectively. We identified 267 DEGs between Interestingly, there was a smaller proportion of patients
LUAD and normal tissues across the three datasets, of with high SCN7A expression in stages III and IV than
which there were 67 overexpressed and 200 suppressed in Stages I and II. Furthermore, compared with the low-
genes (Figure 1A and B). Relying on Metascape data, expression group, the high-expression group had a lower

Volume 2 Issue 1 (2023) 3 https://doi.org/10.36922/gpd.363