Page 196 - IJB-9-3
P. 196

International Journal of Bioprinting                             3D-printed vascularized biofunctional scaffold



            [Sigma], and 50 μg/mL ascorbic acid [Sigma]). ALP staining   2.13. Hematoxylin–eosin staining and
            was performed when the culture reached day 5. To detect   immunofluorescence staining
            the formation of calcified nodules, Alizarin red staining was   Each groups of bone repair scaffolds were fixed, embedded,
            carried out when the culture reached day 14.       and sectioned, followed by hematoxylin–eosin (HE)
                                                               staining and picture acquisition with a Nikon microscope.
            2.9. Assay of macrophage polarization on each      Immunofluorescence staining was performance in
            group of hydrogels                                 accordance with the standard protocol described
            Groups of hydrogel solutions were added to 48-well   previously [29]  with α-SMA (Abcam) or CD31 (Abcam)
            culture plates to prepare hydrogel substrates, light-cured,   antibodies.
            crosslinked, and then crosslinked with Ca . RAW264.7
                                               2+
            cells  were  then  grown  on  the  hydrogel  surface  at  a   2.14. Construction of the rat femoral condyle defect
            density  of  4  ×  10   for  3  days.  Lipopolysaccharide  (LPS)   model and implantation of a bone repair scaffold
                          3
            (100 ng/mL, 8 h) was then added to the culture medium   The rat femoral condyle defect model was utilized to
            (DMEM, Gibco) as an activator of M1 macrophages. Gene   verify the  in vivo bone repair capacity of each group of
            expression of M1-type markers and M2-type markers was   scaffolds. At approximately 8 weeks, male SD rats weighing
            determined by quantitative polymerase chain reaction   approximately 300  g were chosen  for establishing the
            (qPCR), followed by immunofluorescence analysis to   femoral condyle defect model. Briefly, the femoral condyles
            detect arginase 1 (Arg1) and inducible nitric oxide synthase   are exposed through an incision in the distal femur of the
            (iNOS) protein expression. Briefly, RAW264.7 cells were   rat. To avoid thermal necrosis, a cylindrical defect, which is
            gently washed three times with appropriate amount   3 mm in diameter and 4 mm deep, was constructed using a
            of  PBS,  followed  by fixation  with  4% concentration  of   relatively low speed electric drill precooled with iced PBS.
            paraformaldehyde and finally permeabilization with 0.1%   After the fragmented bone was removed, the drill hole was
            Triton X-100. Antibodies against Arg1 (Abcam) and iNOS   flushed with saline, and the scaffold was implanted into the
            (Abcam) were used for immunofluorescence staining.   bone defect. The experiment was divided into four groups:
            Nuclei were stained blue by DAPI and then observed   GA/PCL group, PRP-GA/PCL group, PRP-GA@Lap/PCL
            under fluorescence microscopy.                     group, and blank control group; animal tissue sampling
                                                               was performed 1 month after surgery.
            2.10. Quantitative real-time PCR analysis
            Briefly, total RNA from RAW264.7 was isolated with TRIzol   All protocols involving experimental animals were
            reagent (Invitrogen). The primer sequences were: iNOS:   approved by the Animal Welfare Ethics Committee of the
            forward    5ʹ-(GTTCTCAGCCCAACAATACAAGA)-           Ninth  People’s  Hospital Affiliated  to  Shanghai Jiaotong
            3ʹ and reverse 5ʹ-(GTGGACGGGTCGATGTCAC)-3ʹ;        University School of Medicine.
            CCR7: forward 5ʹ-(GAGGCTCAAGACCATGACGGA)-          2.15. Radiographic evaluation
            3ʹ and reverse 5ʹ-(ATCCAGGACTTGGCTTCGCT)-3ʹ;       The effect of each group of scaffolds on the repair of bone
            Arg1: forward 5ʹ-(GGTGGCAGAGGTCCAGAAGAA)-          defects was examined using a micro-CT system (SkyScan
            3ʹ and reverse 5ʹ-(CCCATGCAGATTCCCAGAGC)-3ʹ;       1176, Bruker, Belgium). The specific scanning parameters
            CD206: forward 5ʹ-(CTCTGTTCAGCTATTGGACGC)-         were as follows: 18 µm resolution, 1 mm aluminum filter,
            3ʹ and reverse 5ʹ-(CGGAATTTCTGGGATTCAGCTTC)-       90 kV voltage, and 250 µA current. Three-dimensional
            3ʹ. GAPDH was used as an internal control for expression   reconstruction was performed using simulation software
            normalization.
                                                               (CTVol). The ratio of bone volume to total tissue
            2.11. Western blot analysis                        volume (BV/TV) and bone mineral density (BMD) was
            The antibodies involved in this study were utilized as   quantified.
            follows: PCNA (Abcam), β-actin (Abcam) and cyclin D1
            (Abcam). An ImageQuant LAS4000 imaging station (GE)   2.16. Statistical analysis
            was used to acquire images.                        Results are expressed as the mean ± standard deviation
                                                               (SD), and statistical analysis was performed using
            2.12. Subcutaneous implantation experiment in rats  GraphPad Prism 8.0. One-way analysis of variance
            After the rats were fully anesthetized, small incisions were   (ANOVA) followed by Tukey’s multiple comparison tests
            made on both sides of their backs, and each group of bone   was applied for comparisons between multiple groups, and
            repair scaffolds was implanted under the skin on both   Student’s  t-tests were applied for comparing differences
            sides of the rats’ backs. The scaffolds were removed at 4   between two groups. Kruskal–Wallis tests were utilized to
            weeks after surgery and the samples were sectioned and   analyze the nonparametric data. A value of P < 0.05 was
            subsequently stained.                              considered statistically significant.


            Volume 9 Issue 3 (2023)                        188                         https://doi.org/10.18063/ijb.702
   191   192   193   194   195   196   197   198   199   200   201