Page 196 - IJB-9-3

International Journal of Bioprinting 3D-printed vascularized biofunctional scaffold

[Sigma], and 50 μg/mL ascorbic acid [Sigma]). ALP staining 2.13. Hematoxylin–eosin staining and
was performed when the culture reached day 5. To detect immunofluorescence staining
the formation of calcified nodules, Alizarin red staining was Each groups of bone repair scaffolds were fixed, embedded,
carried out when the culture reached day 14. and sectioned, followed by hematoxylin–eosin (HE)
staining and picture acquisition with a Nikon microscope.
2.9. Assay of macrophage polarization on each Immunofluorescence staining was performance in
group of hydrogels accordance with the standard protocol described
Groups of hydrogel solutions were added to 48-well previously [29] with α-SMA (Abcam) or CD31 (Abcam)
culture plates to prepare hydrogel substrates, light-cured, antibodies.
crosslinked, and then crosslinked with Ca . RAW264.7
2+
cells were then grown on the hydrogel surface at a 2.14. Construction of the rat femoral condyle defect
density of 4 × 10 for 3 days. Lipopolysaccharide (LPS) model and implantation of a bone repair scaffold
3
(100 ng/mL, 8 h) was then added to the culture medium The rat femoral condyle defect model was utilized to
(DMEM, Gibco) as an activator of M1 macrophages. Gene verify the in vivo bone repair capacity of each group of
expression of M1-type markers and M2-type markers was scaffolds. At approximately 8 weeks, male SD rats weighing
determined by quantitative polymerase chain reaction approximately 300 g were chosen for establishing the
(qPCR), followed by immunofluorescence analysis to femoral condyle defect model. Briefly, the femoral condyles
detect arginase 1 (Arg1) and inducible nitric oxide synthase are exposed through an incision in the distal femur of the
(iNOS) protein expression. Briefly, RAW264.7 cells were rat. To avoid thermal necrosis, a cylindrical defect, which is
gently washed three times with appropriate amount 3 mm in diameter and 4 mm deep, was constructed using a
of PBS, followed by fixation with 4% concentration of relatively low speed electric drill precooled with iced PBS.
paraformaldehyde and finally permeabilization with 0.1% After the fragmented bone was removed, the drill hole was
Triton X-100. Antibodies against Arg1 (Abcam) and iNOS flushed with saline, and the scaffold was implanted into the
(Abcam) were used for immunofluorescence staining. bone defect. The experiment was divided into four groups:
Nuclei were stained blue by DAPI and then observed GA/PCL group, PRP-GA/PCL group, PRP-GA@Lap/PCL
under fluorescence microscopy. group, and blank control group; animal tissue sampling
was performed 1 month after surgery.
2.10. Quantitative real-time PCR analysis
Briefly, total RNA from RAW264.7 was isolated with TRIzol All protocols involving experimental animals were
reagent (Invitrogen). The primer sequences were: iNOS: approved by the Animal Welfare Ethics Committee of the
forward 5ʹ-(GTTCTCAGCCCAACAATACAAGA)- Ninth People’s Hospital Affiliated to Shanghai Jiaotong
3ʹ and reverse 5ʹ-(GTGGACGGGTCGATGTCAC)-3ʹ; University School of Medicine.
CCR7: forward 5ʹ-(GAGGCTCAAGACCATGACGGA)- 2.15. Radiographic evaluation
3ʹ and reverse 5ʹ-(ATCCAGGACTTGGCTTCGCT)-3ʹ; The effect of each group of scaffolds on the repair of bone
Arg1: forward 5ʹ-(GGTGGCAGAGGTCCAGAAGAA)- defects was examined using a micro-CT system (SkyScan
3ʹ and reverse 5ʹ-(CCCATGCAGATTCCCAGAGC)-3ʹ; 1176, Bruker, Belgium). The specific scanning parameters
CD206: forward 5ʹ-(CTCTGTTCAGCTATTGGACGC)- were as follows: 18 µm resolution, 1 mm aluminum filter,
3ʹ and reverse 5ʹ-(CGGAATTTCTGGGATTCAGCTTC)- 90 kV voltage, and 250 µA current. Three-dimensional
3ʹ. GAPDH was used as an internal control for expression reconstruction was performed using simulation software
normalization.
(CTVol). The ratio of bone volume to total tissue
2.11. Western blot analysis volume (BV/TV) and bone mineral density (BMD) was
The antibodies involved in this study were utilized as quantified.
follows: PCNA (Abcam), β-actin (Abcam) and cyclin D1
(Abcam). An ImageQuant LAS4000 imaging station (GE) 2.16. Statistical analysis
was used to acquire images. Results are expressed as the mean ± standard deviation
(SD), and statistical analysis was performed using
2.12. Subcutaneous implantation experiment in rats GraphPad Prism 8.0. One-way analysis of variance
After the rats were fully anesthetized, small incisions were (ANOVA) followed by Tukey’s multiple comparison tests
made on both sides of their backs, and each group of bone was applied for comparisons between multiple groups, and
repair scaffolds was implanted under the skin on both Student’s t-tests were applied for comparing differences
sides of the rats’ backs. The scaffolds were removed at 4 between two groups. Kruskal–Wallis tests were utilized to
weeks after surgery and the samples were sectioned and analyze the nonparametric data. A value of P < 0.05 was
subsequently stained. considered statistically significant.

Volume 9 Issue 3 (2023) 188 https://doi.org/10.18063/ijb.702