Page 18 - AN-1-3

Advanced Neurologyurology
Advanced Ne Early inhibition of PDK1 prevents AD-like pathology

3-phosphoinositide-dependent protein kinase 1 Cre mice [31-34] . In this study, Emx1-Cre mice were bred
(PDK1) is a well-known member in the phosphoinositide with 5×FAD (APP/PS1) [30,35,36] and floxed Pdk1 f/f[28,37-39]
3 kinase (PI3K) pathway. The PI3K signaling pathway has to generate Pdk1 ;Emx1-Cre;APP/PS1 mice, termed as
f/f
important physiological roles, including cell proliferation, Pdk1 cKO/5×FAD hereafter. Amyloid plaques were hardly
cell metabolism, angiogenesis, and so on [13-21] . Evidence detected in Pdk1 cKO/5×FAD cortices, and the population
has suggested that PDK1 may be involved in AD. First, of ionized calcium-binding adaptor molecule 1 (Iba1)+
it has been shown that AD patients exhibit enhanced cells decreased significantly. Furthermore, there was a
PDK1 activity in the brain compared with control subjects significant decrease in APP levels in Pdk1 cKO/5×FAD
without AD [22,23] . Second, a recent transcriptomic study mice compared with their 5×FAD littermates. The above
demonstrated a significant increase in PDK1 mRNA findings support the notion that early inhibition of PDK1
levels in excitatory neurons in the prefrontal cortex of AD may effectively prevent AD-like pathology.
[24]
patients compared with control subjects . Third, it has
been found that PDK1 activity is enhanced in several lines 2. Materials and methods
of amyloid precursor protein (APP) transgenic (Tg) mice, 2.1. Mice
including Tg2576, APP/presenilin-1 (PS1), and 3×Tg-AD
mice [22,25,26] . Moreover, previous evidence has shown that The mouse work was performed in accordance with the
BX912, a potent PDK1 inhibitor, significantly diminishes Guide for the Care and Use of Laboratory Animals of
Nanjing University. The background strain for male and
amyloid plaques and improves spatial memory in mouse female mice was C57BL/6. All mouse lines, including
models of AD , raising a possibility that PDK1 may serve f/f
[22]
as a therapeutic target for AD. Pdk1 , Emx1-Cre, and 5×FAD mice, are described in our
previous studies [15,28,33,35,37] . The mice were maintained in
Pietri et al. explored the mechanisms underlying an animal facility at the Model Animal Research Center
BX912-induced beneficial effects in mouse models of of Nanjing University. They were group-housed in a room
AD. They found that BX912 increases the activity of without specific pathogens. The room temperature was
α-secretase through tumor necrosis factor-α-converting maintained at 25 ± 1°C, and the mice had unrestricted
enzyme (TACE), promotes the trans-localization of access to food and water. The animal protocol (AP) for this
TACE into the plasma membrane, restores α-secretase- study was approved by the Institutional Animal Care and
dependent cleavage of APP, and attenuates Aβ-induced Use Committee (IACUC) of Nanjing University.
neurotoxicity . The study suggests that the inhibition of The following primers were used for genotyping: Primers
[22]
PDK1 may be effective in halting AD. However, serious for floxed Pdk1 were TGTGCTTGGTGGATATTGAT
side effects have been reported from the inhibition of (forward) and AAGGAGGAGAGGAGGAATGT
PDK1 pharmacologically or genetically. First, long-term (reverse); primers for human APP were
treatment with BX912 results in the death of adult APP Tg AGGACTGACCACTCGACCAG (forward) and
[22]
mice . Second, a straight knockout (KO) of PDK1 causes CGGGGGTCTAGTTCTGCAT (reverse); primers for
embryonic lethality in mice . Third, neural progenitor cell human PS1 were AATAGA GAACGGCAGGAGCA
[27]
(NPC)-specific inactivation of PDK1 results in apoptosis (forward) and GCCATGAGGGCACTAATCAT
of cortical neurons and impairs spatial learning in mice . (reverse); and primers for Cre were
[28]
Fourth, interneuron- or oligodendrocyte-specific deletion GCCTGCATTACCGGTCGATGCAACGA (forward) and
of PDK1 or its substrate Akt leads to postnatal death in GTGGCAGATGGCGCGGCAACACCATT (reverse).
mice before the age of day 21 (P21) [15,16,29] .
In response to the findings of Pietri et al., we propose 2.2. Tissue preparation for biochemical and
that early inhibition of PDK1 function may prevent morphological studies
AD-like pathology in APP Tg mice. To test this hypothesis, The mice were perfused with cold phosphate-buffered
we employed a genetic strategy to inactivate PDK1 in the solution (PBS) . The brain was cut sagittally into
[40]
developing cortices of 5×FAD mice. The latter, which have two hemispheres, in which the cortex was dissected
been widely used in the field of AD, are known to express from one hemisphere to prepare protein samples. The
five mutations on human APP and PS1 genes . It has other hemisphere was fixed in 4% paraformaldehyde
[30]
been reported that plaque pathology begins to become (PFA) (Aladdin Biochemical Technology, C104188) at
apparent in the cortex and the subiculum in 5×FAD mice 4°C overnight and then dehydrated using a series of
at 2 months . On the other hand, Cre is known to be ethanol solutions (Nanjing Reagent, C0691510225). The
[30]
expressed mainly in NPCs in the developing cortex and dehydrated brain hemispheres were embedded in a paraffin
in excitatory neurons in the postnatal forebrain of Emx1- machine (Leica Biosystems, 39601095) for the preparation

Volume 1 Issue 3 (2022) 2 https://doi.org/10.36922/an.v1i3.153