Page 54 - TD-2-1

Tumor Discovery LCP2 regulates melanoma progression

2.6. Cell culture, stimulation, and cell transfection Table 1. Primer sequences used for the RT‑qPCR

A375 and B16F10 cells were purchased from ATCC. They Gene Primer sequence (5’ to 3’)
were cultured in DMEM (01-052-1A, Biological Industries, LCP2
Israel) cell culture medium with 10% fetal bovine serum Forward AGAATGTCCCGTTTCGCTCAG
(04-001-1ACS, Biological Industries, Israel). In cell culture
experiments, transfection of LCP2 shRNA (GenePharma Reverse TGCTCCTTCTCTCTTCGTTCTT
Biotechnology Company, Shanghai, China) was conducted IRF5
based on the operation manual. Non-targeting shRNA Forward AGAGACAGGGAAGTACACTGAAG
was used as a control. shRNAs were transfected into A375 Reverse TGGAAGTCACGGCTTTTGTTAAG
and B16F10 cells with Lipofectaminected i (L3000015, GAPDH
Invitrogen) according to corresponding instructions. For Forward CTCTGCTCCTCCTGTTCGAC
obtaining stable LCP2 knockdown cells, pMD2.G, psPAX2,
and shRNA were cotransfected into HEK-293T cells with Reverse GCCCAATACGACCAAATCC
TurboFect (R0532, Thermo Fisher Scientific) based on the RT-qPCR: Real time-quantitative polymerase chain reaction
corresponding operation manual. RT-PCR was used for 2.10. Identification of differentially expressed genes
efficiency verification of transfection.
associated with LCP2
2.7. Animal studies To further explore the mechanism of LCP2 regulating
Female BALB/c nude mice (4-6 weeks old) and female C57BL/6 progression of melanoma, we analyzed the DEGs between
mice (6-8 weeks old) were used for A375 experiments and LCP2 knockdown group and control group. Ribo-Zero
B16F10 experiments, respectively. 1ect A375 or B16F10 cells rRNA removal kit was used to remove rRNA from 1 μg
6
(0.1 mL) were subcutaneously implanted to female nude or of total RNA. TruSeq RNA sample prep kit (Illumina) was
C57BL/6 mice. To determine tumor growth, a caliper was used to generate sequencing libraries, and then sequenced
used to record the tumor sizes every 5 days. All animal studies as 151-bp paired-end reads using an Illumina HiSeq X
were evaluated and approved by the Institutional Animal Ten platform, with P < 0.05 and |foldchange| > 1 as cutoff
Care and Use Committee of Xiangya Hospital, Central South value.
University (No. 2022020685).
2.11. Statistical analysis
2.8. RT-qPCR
All data from the experiments are expressed as mean ± SEM.
Tripure (Bio Teke, RP1002) and a reverse transcription kit Statistical analyses of these data were performed using
(HiScript Q RT, Vazyme, R223-01) were used to extract GraphPad Prism 9 (GraphPad Software, La Jolla, CA) with
the total RNA and reverse-transcribe RNA into cDNA, an unpaired Student’s t-test or Tukey’s multiple comparison.
respectively. The PCR system was prepared according to P < 0.05 was set as a cutoff for significant difference.
the SYBR qPCR Mix kit (Bimake, B21703). The relatively
expression levels of LCP2 and IRF5 were detected by 3. Results
normalization to GAPDH using ΔΔCt method. The primer 3.1. Identification of DEGs
sequences used for the RT-qPCR are listed in Table 1.
Among the 2070 immune-centric genes, there were
2.9. Flow cytometry 1582 immune-centric genes in GSE3189 data set and
2% paraformaldehyde solution in phosphate-buffered 1842 in GSE31879 data set. Based on the criteria of FDR
saline (PBS) was used for cell fixation, then stained with q value < 0.01, the number of DEGs between melanoma
fluorescent-labeled antibodies for cell-surface markers and nevus, melanoma and normal skin, and melanoma and
for 1 h at 4°C in the dark, and subsequently washed and melanocyte were 720, 801, and 335, respectively, in GSE3189
resuspended for flow cytometry analysis. The antibodies and GSE31879 data sets. The intersection of these three
used in this part are as follows: anti-mouse CD4 FITC comparisons was 105, which were differently expressed
(100406), anti-mouse CD45 APC (103112), anti-mouse in all three comparisons (Figure 1A). Among 105 genes,
CD4 PE (100407), anti-mouse/human Granzyme B 47 were confirmed as DEGs in GSE15605 (Figure 1B). GO
PE (372208), AF647 anti-human/mouse Granzyme B functional enrichment analysis showed that the changes
antibody (515405), and anti-mouse CD8 APC (100766). in 47 genes were mainly related to the biological processes
The FACSCalibur (BD Biosciences) and FlowJo software of neutrophil and autophagy (Figure 1C). KEGG pathway
(Version 10.4) were used for flow cytometry analysis and enrichment analysis demonstrated that these 47 DEGs
data analysis, respectively. were significantly involved in lysosome, B-cell receptor

Volume 2 Issue 1 (2023) 4 https://doi.org/10.36922/td.308